![](http://cucurbitgenomics.org/sites/default/files/styles/slideshow/public/carousel/101322_web.jpg?itok=EG-G51x6)
IVF0002342 (gene) Melon (IVF77) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: exonCDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGGAGATTCTACGCAGTCAGAAATTGATACAGAAAAGGGGTTCGACAGGAAAGTCCTTTCAATCCAATCCATTCTTGAAGTCCAATAAAGACAAAGGATATGTCAGTGACCTAGCACGAGAAAGCACTCTCCGAAGGCATGAAATGTCCAATTTTTTTCTTCAAAATCATTATAGGAATAGTAATGTCTTTCTTAAATTCTCTGGCCGAAATATATAA ATGGAGATTCTACGCAGTCAGAAATTGATACAGAAAAGGGGTTCGACAGGAAAGTCCTTTCAATCCAATCCATTCTTGAAGTCCAATAAAGACAAAGGATATGTCAGTGACCTAGCACGAGAAAGCACTCTCCGAAGGCATGAAATGTCCAATTTTTTTCTTCAAAATCATTATAGGAATAGTAATGTCTTTCTTAAATTCTCTGGCCGAAATATATAA ATGGAGATTCTACGCAGTCAGAAATTGATACAGAAAAGGGGTTCGACAGGAAAGTCCTTTCAATCCAATCCATTCTTGAAGTCCAATAAAGACAAAGGATATGTCAGTGACCTAGCACGAGAAAGCACTCTCCGAAGGCATGAAATGTCCAATTTTTTTCTTCAAAATCATTATAGGAATAGTAATGTCTTTCTTAAATTCTCTGGCCGAAATATATAA MEILRSQKLIQKRGSTGKSFQSNPFLKSNKDKGYVSDLARESTLRRHEMSNFFLQNHYRNSNVFLKFSGRNI Homology
BLAST of IVF0002342 vs. ExPASy Swiss-Prot
Match: Q05492 (60S ribosomal protein L5, mitochondrial OS=Oenothera berteroana OX=3950 GN=RPL5 PE=2 SV=2) HSP 1 Score: 82.0 bits (201), Expect = 3.0e-15 Identity = 43/56 (76.79%), Postives = 49/56 (87.50%), Query Frame = 0
BLAST of IVF0002342 vs. ExPASy Swiss-Prot
Match: P49388 (60S ribosomal protein L5, mitochondrial OS=Brassica napus OX=3708 GN=RPL5 PE=3 SV=2) HSP 1 Score: 79.7 bits (195), Expect = 1.5e-14 Identity = 43/53 (81.13%), Postives = 46/53 (86.79%), Query Frame = 0
BLAST of IVF0002342 vs. ExPASy Swiss-Prot
Match: P42793 (60S ribosomal protein L5, mitochondrial OS=Arabidopsis thaliana OX=3702 GN=RPL5 PE=1 SV=1) HSP 1 Score: 77.4 bits (189), Expect = 7.3e-14 Identity = 42/56 (75.00%), Postives = 47/56 (83.93%), Query Frame = 0
BLAST of IVF0002342 vs. ExPASy Swiss-Prot
Match: P51409 (60S ribosomal protein L5, mitochondrial OS=Solanum tuberosum OX=4113 GN=RPL5 PE=2 SV=2) HSP 1 Score: 67.4 bits (163), Expect = 7.6e-11 Identity = 39/56 (69.64%), Postives = 46/56 (82.14%), Query Frame = 0
BLAST of IVF0002342 vs. ExPASy TrEMBL
Match: A0A5A7SYB1 (Ribosomal protein L5 (Mitochondrion) OS=Cucumis melo var. makuwa OX=1194695 GN=E6C27_scaffold48303G00010 PE=3 SV=1) HSP 1 Score: 92.8 bits (229), Expect = 6.2e-16 Identity = 47/52 (90.38%), Postives = 49/52 (94.23%), Query Frame = 0
BLAST of IVF0002342 vs. ExPASy TrEMBL
Match: G3EU44 (Ribosomal protein L5 OS=Cucumis melo subsp. melo OX=412675 GN=rpl5 PE=3 SV=1) HSP 1 Score: 92.8 bits (229), Expect = 6.2e-16 Identity = 47/52 (90.38%), Postives = 49/52 (94.23%), Query Frame = 0
BLAST of IVF0002342 vs. ExPASy TrEMBL
Match: A0A3S9JIG3 (Ribosomal protein L5 OS=Cucumis melo var. momordica OX=2034244 GN=rpl5 PE=3 SV=1) HSP 1 Score: 92.8 bits (229), Expect = 6.2e-16 Identity = 47/52 (90.38%), Postives = 49/52 (94.23%), Query Frame = 0
BLAST of IVF0002342 vs. ExPASy TrEMBL
Match: G3EIZ3 (Ribosomal protein L5 OS=Cucumis sativus OX=3659 GN=rpl5 PE=3 SV=1) HSP 1 Score: 89.4 bits (220), Expect = 6.9e-15 Identity = 45/55 (81.82%), Postives = 49/55 (89.09%), Query Frame = 0
BLAST of IVF0002342 vs. ExPASy TrEMBL
Match: Q7Y6H0 (Ribosomal protein L5 OS=Cucumis sativus OX=3659 GN=rpl5 PE=3 SV=1) HSP 1 Score: 86.3 bits (212), Expect = 5.8e-14 Identity = 44/55 (80.00%), Postives = 48/55 (87.27%), Query Frame = 0
BLAST of IVF0002342 vs. NCBI nr
Match: AEN56134.1 (ribosomal protein L5 [Cucumis melo subsp. melo] >AZP40310.1 ribosomal protein L5 [Cucumis melo var. momordica]) HSP 1 Score: 94.0 bits (232), Expect = 6.00e-22 Identity = 47/52 (90.38%), Postives = 49/52 (94.23%), Query Frame = 0
BLAST of IVF0002342 vs. NCBI nr
Match: KAA0034876.1 (ribosomal protein L5 [Cucumis melo var. makuwa]) HSP 1 Score: 94.0 bits (232), Expect = 1.65e-21 Identity = 47/52 (90.38%), Postives = 49/52 (94.23%), Query Frame = 0
BLAST of IVF0002342 vs. NCBI nr
Match: YP_004849341.1 (ribosomal protein L5 [Cucumis sativus] >ADZ10768.1 ribosomal protein L5 [Cucumis sativus]) HSP 1 Score: 90.5 bits (223), Expect = 1.47e-20 Identity = 45/55 (81.82%), Postives = 49/55 (89.09%), Query Frame = 0
BLAST of IVF0002342 vs. NCBI nr
Match: AAP33159.1 (ribosomal protein L5 [Cucumis sativus] >AAP33161.1 ribosomal protein L5 [Cucumis sativus] >AAP33162.1 ribosomal protein L5 [Cucumis sativus]) HSP 1 Score: 87.4 bits (215), Expect = 2.33e-19 Identity = 44/55 (80.00%), Postives = 48/55 (87.27%), Query Frame = 0
BLAST of IVF0002342 vs. NCBI nr
Match: PKI31295.1 (hypothetical protein CRG98_048315 [Punica granatum]) HSP 1 Score: 82.4 bits (202), Expect = 4.74e-18 Identity = 43/56 (76.79%), Postives = 49/56 (87.50%), Query Frame = 0
BLAST of IVF0002342 vs. TAIR 10
Match: AT2G07725.1 (Ribosomal L5P family protein ) HSP 1 Score: 79.7 bits (195), Expect = 1.0e-15 Identity = 43/53 (81.13%), Postives = 46/53 (86.79%), Query Frame = 0
BLAST of IVF0002342 vs. TAIR 10
Match: ATMG00210.1 (ribosomal protein L5 ) HSP 1 Score: 79.7 bits (195), Expect = 1.0e-15 Identity = 43/53 (81.13%), Postives = 46/53 (86.79%), Query Frame = 0
The following BLAST results are available for this feature:
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|