HG10017182 (gene) Bottle gourd (Hangzhou Gourd) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: CDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGAATATTCTATTATGTTCTATCAACACACAAAAGGGGTTATACGATATATCTGGTGTGGAAGTCGGCCAACATTTGTATTGGCAAATAGGAGGTTTCCAAGTACATGCCCAAGTACTTATTACTTCTTGGGTTGTAATTGCTATCTTATTAGGTTCAGCCATTATAGCTGTTCGTAATCCACAAACCATTCCTACTGACGGTCAGAATTTCTTCAAATATGTCCTTGAATTCATTCGAGACGTGAGCAAAACTCAGATTGGCGAAGAATATGGTCCATGGGCACTTAGAATATTGCTTACCCTTGAGGTGGAAGAATGA ATGAATATTCTATTATGTTCTATCAACACACAAAAGGGGTTATACGATATATCTGGTGTGGAAGTCGGCCAACATTTGTATTGGCAAATAGGAGGTTTCCAAGTACATGCCCAAGTACTTATTACTTCTTGGGTTGTAATTGCTATCTTATTAGGTTCAGCCATTATAGCTGTTCGTAATCCACAAACCATTCCTACTGACGGTCAGAATTTCTTCAAATATGTCCTTGAATTCATTCGAGACGTGAGCAAAACTCAGATTGGCGAAGAATATGGTCCATGGGCACTTAGAATATTGCTTACCCTTGAGGTGGAAGAATGA ATGAATATTCTATTATGTTCTATCAACACACAAAAGGGGTTATACGATATATCTGGTGTGGAAGTCGGCCAACATTTGTATTGGCAAATAGGAGGTTTCCAAGTACATGCCCAAGTACTTATTACTTCTTGGGTTGTAATTGCTATCTTATTAGGTTCAGCCATTATAGCTGTTCGTAATCCACAAACCATTCCTACTGACGGTCAGAATTTCTTCAAATATGTCCTTGAATTCATTCGAGACGTGAGCAAAACTCAGATTGGCGAAGAATATGGTCCATGGGCACTTAGAATATTGCTTACCCTTGAGGTGGAAGAATGA MNILLCSINTQKGLYDISGVEVGQHLYWQIGGFQVHAQVLITSWVVIAILLGSAIIAVRNPQTIPTDGQNFFKYVLEFIRDVSKTQIGEEYGPWALRILLTLEVEE Homology
BLAST of HG10017182 vs. NCBI nr
Match: AHM88818.1 (ATP synthase CF0 subunit IV [Lagenaria siceraria]) HSP 1 Score: 194.1 bits (492), Expect = 6.0e-46 Identity = 93/94 (98.94%), Postives = 94/94 (100.00%), Query Frame = 0
BLAST of HG10017182 vs. NCBI nr
Match: YP_009752654.1 (CF0 subunit IV [Ampelosycios humblotii] >QIT05135.1 CF0 subunit IV [Ampelosycios humblotii]) HSP 1 Score: 194.1 bits (492), Expect = 6.0e-46 Identity = 93/94 (98.94%), Postives = 94/94 (100.00%), Query Frame = 0
BLAST of HG10017182 vs. NCBI nr
Match: AHM91176.1 (ATP synthase CF0 subunit IV [Lagenaria siceraria]) HSP 1 Score: 194.1 bits (492), Expect = 6.0e-46 Identity = 93/94 (98.94%), Postives = 94/94 (100.00%), Query Frame = 0
BLAST of HG10017182 vs. NCBI nr
Match: YP_009751726.1 (CF0 subunit IV [Herpetospermum pedunculosum] >QIT04459.1 CF0 subunit IV [Herpetospermum pedunculosum] >QJR52944.1 ATP synthase CF0 subunit IV [Herpetospermum pedunculosum]) HSP 1 Score: 194.1 bits (492), Expect = 6.0e-46 Identity = 93/94 (98.94%), Postives = 94/94 (100.00%), Query Frame = 0
BLAST of HG10017182 vs. NCBI nr
Match: AHM91116.1 (ATP synthase CF0 subunit IV [Lagenaria siceraria]) HSP 1 Score: 194.1 bits (492), Expect = 6.0e-46 Identity = 93/94 (98.94%), Postives = 94/94 (100.00%), Query Frame = 0
BLAST of HG10017182 vs. ExPASy Swiss-Prot
Match: Q4VZP5 (ATP synthase subunit a, chloroplastic OS=Cucumis sativus OX=3659 GN=atpI PE=3 SV=1) HSP 1 Score: 194.1 bits (492), Expect = 7.9e-49 Identity = 93/94 (98.94%), Postives = 94/94 (100.00%), Query Frame = 0
BLAST of HG10017182 vs. ExPASy Swiss-Prot
Match: Q09X29 (ATP synthase subunit a, chloroplastic OS=Morus indica OX=248361 GN=atpI PE=3 SV=1) HSP 1 Score: 187.2 bits (474), Expect = 9.6e-47 Identity = 88/94 (93.62%), Postives = 93/94 (98.94%), Query Frame = 0
BLAST of HG10017182 vs. ExPASy Swiss-Prot
Match: Q0G9N1 (ATP synthase subunit a, chloroplastic OS=Liriodendron tulipifera OX=3415 GN=atpI PE=3 SV=1) HSP 1 Score: 183.7 bits (465), Expect = 1.1e-45 Identity = 87/94 (92.55%), Postives = 90/94 (95.74%), Query Frame = 0
BLAST of HG10017182 vs. ExPASy Swiss-Prot
Match: Q09G58 (ATP synthase subunit a, chloroplastic OS=Platanus occidentalis OX=4403 GN=atpI PE=3 SV=1) HSP 1 Score: 183.3 bits (464), Expect = 1.4e-45 Identity = 86/94 (91.49%), Postives = 90/94 (95.74%), Query Frame = 0
BLAST of HG10017182 vs. ExPASy Swiss-Prot
Match: Q4FGF5 (ATP synthase subunit a, chloroplastic OS=Ranunculus macranthus OX=334596 GN=atpI PE=3 SV=1) HSP 1 Score: 183.3 bits (464), Expect = 1.4e-45 Identity = 86/94 (91.49%), Postives = 90/94 (95.74%), Query Frame = 0
BLAST of HG10017182 vs. ExPASy TrEMBL
Match: A0A218KG29 (ATP synthase subunit a, chloroplastic OS=Cucumis sativus var. hardwickii OX=319220 GN=atpI PE=3 SV=1) HSP 1 Score: 194.1 bits (492), Expect = 2.9e-46 Identity = 93/94 (98.94%), Postives = 94/94 (100.00%), Query Frame = 0
BLAST of HG10017182 vs. ExPASy TrEMBL
Match: G3ETX3 (ATP synthase subunit a, chloroplastic OS=Cucumis melo subsp. melo OX=412675 GN=atpI PE=3 SV=1) HSP 1 Score: 194.1 bits (492), Expect = 2.9e-46 Identity = 93/94 (98.94%), Postives = 94/94 (100.00%), Query Frame = 0
BLAST of HG10017182 vs. ExPASy TrEMBL
Match: A0A1X9Q128 (ATP synthase subunit a, chloroplastic OS=Cucumis sativus OX=3659 GN=atpI PE=3 SV=1) HSP 1 Score: 194.1 bits (492), Expect = 2.9e-46 Identity = 93/94 (98.94%), Postives = 94/94 (100.00%), Query Frame = 0
BLAST of HG10017182 vs. ExPASy TrEMBL
Match: A0A1S4ETZ3 (ATP synthase subunit a, chloroplastic OS=Cucumis melo OX=3656 GN=atpI PE=3 SV=1) HSP 1 Score: 194.1 bits (492), Expect = 2.9e-46 Identity = 93/94 (98.94%), Postives = 94/94 (100.00%), Query Frame = 0
BLAST of HG10017182 vs. ExPASy TrEMBL
Match: A0A249RZA4 (ATP synthase subunit a, chloroplastic OS=Cucumis melo var. cantalupensis OX=3658 GN=atpI PE=3 SV=1) HSP 1 Score: 194.1 bits (492), Expect = 2.9e-46 Identity = 93/94 (98.94%), Postives = 94/94 (100.00%), Query Frame = 0
BLAST of HG10017182 vs. TAIR 10
Match: ATCG00150.1 (ATPase, F0 complex, subunit A protein ) HSP 1 Score: 177.2 bits (448), Expect = 7.1e-45 Identity = 83/96 (86.46%), Postives = 92/96 (95.83%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Bottle gourd (Hangzhou Gourd) v1
Date Performed: 2022-08-01
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|