HG10007084 (gene) Bottle gourd (Hangzhou Gourd) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: CDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGGGAGACCATAATGGGGATGAGTTTCTTGAGCTACCAATTGCCAATGTTGGGAGAATAATGAAGAAGATACTTCCCCAAAAGGCCAAGATTTCAAAAGAAGCCAAGAAGACAATGCAAGAATGTGCAAATGAGTTCATTAGCTTTGTAACAAATGAAGCAGCACAAAGATGTCACCAAGAGAATCGAAGAACTCTCAATGGAGATGATATTTGTTGGGCTTTTGGTTCTTATGGCTTAGATAACTTTGCTGAAATTTCTTCCAAGTACTTGCTTAAGTTTAGGGAAGTTGAGAGAATCAAGGCTCATCAATATGAATGCAAAATTACTCAACAACTTCAAGAAGAAGAAGATGAAGATGATGAATGA ATGGGAGACCATAATGGGGATGAGTTTCTTGAGCTACCAATTGCCAATGTTGGGAGAATAATGAAGAAGATACTTCCCCAAAAGGCCAAGATTTCAAAAGAAGCCAAGAAGACAATGCAAGAATGTGCAAATGAGTTCATTAGCTTTGTAACAAATGAAGCAGCACAAAGATGTCACCAAGAGAATCGAAGAACTCTCAATGGAGATGATATTTGTTGGGCTTTTGGTTCTTATGGCTTAGATAACTTTGCTGAAATTTCTTCCAAGTACTTGCTTAAGTTTAGGGAAGTTGAGAGAATCAAGGCTCATCAATATGAATGCAAAATTACTCAACAACTTCAAGAAGAAGAAGATGAAGATGATGAATGA ATGGGAGACCATAATGGGGATGAGTTTCTTGAGCTACCAATTGCCAATGTTGGGAGAATAATGAAGAAGATACTTCCCCAAAAGGCCAAGATTTCAAAAGAAGCCAAGAAGACAATGCAAGAATGTGCAAATGAGTTCATTAGCTTTGTAACAAATGAAGCAGCACAAAGATGTCACCAAGAGAATCGAAGAACTCTCAATGGAGATGATATTTGTTGGGCTTTTGGTTCTTATGGCTTAGATAACTTTGCTGAAATTTCTTCCAAGTACTTGCTTAAGTTTAGGGAAGTTGAGAGAATCAAGGCTCATCAATATGAATGCAAAATTACTCAACAACTTCAAGAAGAAGAAGATGAAGATGATGAATGA MGDHNGDEFLELPIANVGRIMKKILPQKAKISKEAKKTMQECANEFISFVTNEAAQRCHQENRRTLNGDDICWAFGSYGLDNFAEISSKYLLKFREVERIKAHQYECKITQQLQEEEDEDDE Homology
BLAST of HG10007084 vs. NCBI nr
Match: KAA0050890.1 (nuclear transcription factor Y subunit B-4 [Cucumis melo var. makuwa]) HSP 1 Score: 194.5 bits (493), Expect = 5.3e-46 Identity = 95/119 (79.83%), Postives = 108/119 (90.76%), Query Frame = 0
BLAST of HG10007084 vs. NCBI nr
Match: XP_008451142.1 (PREDICTED: nuclear transcription factor Y subunit B-4 [Cucumis melo] >TYK10242.1 nuclear transcription factor Y subunit B-4 [Cucumis melo var. makuwa]) HSP 1 Score: 191.8 bits (486), Expect = 3.4e-45 Identity = 94/119 (78.99%), Postives = 107/119 (89.92%), Query Frame = 0
BLAST of HG10007084 vs. NCBI nr
Match: XP_022961414.1 (nuclear transcription factor Y subunit B-4-like [Cucurbita moschata]) HSP 1 Score: 175.3 bits (443), Expect = 3.3e-40 Identity = 87/119 (73.11%), Postives = 106/119 (89.08%), Query Frame = 0
BLAST of HG10007084 vs. NCBI nr
Match: KAG6590402.1 (Nuclear transcription factor Y subunit B-4, partial [Cucurbita argyrosperma subsp. sororia]) HSP 1 Score: 174.9 bits (442), Expect = 4.3e-40 Identity = 87/122 (71.31%), Postives = 108/122 (88.52%), Query Frame = 0
BLAST of HG10007084 vs. NCBI nr
Match: XP_022968852.1 (nuclear transcription factor Y subunit B-4-like [Cucurbita maxima]) HSP 1 Score: 174.5 bits (441), Expect = 5.7e-40 Identity = 87/122 (71.31%), Postives = 108/122 (88.52%), Query Frame = 0
BLAST of HG10007084 vs. ExPASy Swiss-Prot
Match: O04027 (Nuclear transcription factor Y subunit B-4 OS=Arabidopsis thaliana OX=3702 GN=NFYB4 PE=1 SV=1) HSP 1 Score: 129.4 bits (324), Expect = 2.7e-29 Identity = 61/93 (65.59%), Postives = 77/93 (82.80%), Query Frame = 0
BLAST of HG10007084 vs. ExPASy Swiss-Prot
Match: O82248 (Nuclear transcription factor Y subunit B-5 OS=Arabidopsis thaliana OX=3702 GN=NFYB5 PE=1 SV=1) HSP 1 Score: 122.9 bits (307), Expect = 2.6e-27 Identity = 57/94 (60.64%), Postives = 73/94 (77.66%), Query Frame = 0
BLAST of HG10007084 vs. ExPASy Swiss-Prot
Match: Q9FGJ3 (Nuclear transcription factor Y subunit B-2 OS=Arabidopsis thaliana OX=3702 GN=NFYB2 PE=1 SV=1) HSP 1 Score: 112.8 bits (281), Expect = 2.7e-24 Identity = 52/87 (59.77%), Postives = 67/87 (77.01%), Query Frame = 0
BLAST of HG10007084 vs. ExPASy Swiss-Prot
Match: O23310 (Nuclear transcription factor Y subunit B-3 OS=Arabidopsis thaliana OX=3702 GN=NFYB3 PE=1 SV=1) HSP 1 Score: 111.3 bits (277), Expect = 7.7e-24 Identity = 51/87 (58.62%), Postives = 67/87 (77.01%), Query Frame = 0
BLAST of HG10007084 vs. ExPASy Swiss-Prot
Match: Q9SIT9 (Nuclear transcription factor Y subunit B-7 OS=Arabidopsis thaliana OX=3702 GN=NFYB7 PE=1 SV=1) HSP 1 Score: 111.3 bits (277), Expect = 7.7e-24 Identity = 56/118 (47.46%), Postives = 82/118 (69.49%), Query Frame = 0
BLAST of HG10007084 vs. ExPASy TrEMBL
Match: A0A5A7U6S7 (Nuclear transcription factor Y subunit B-4 OS=Cucumis melo var. makuwa OX=1194695 GN=E6C27_scaffold761G00150 PE=3 SV=1) HSP 1 Score: 194.5 bits (493), Expect = 2.6e-46 Identity = 95/119 (79.83%), Postives = 108/119 (90.76%), Query Frame = 0
BLAST of HG10007084 vs. ExPASy TrEMBL
Match: A0A5D3CG76 (Nuclear transcription factor Y subunit B-4 OS=Cucumis melo var. makuwa OX=1194695 GN=E5676_scaffold16G003890 PE=3 SV=1) HSP 1 Score: 191.8 bits (486), Expect = 1.7e-45 Identity = 94/119 (78.99%), Postives = 107/119 (89.92%), Query Frame = 0
BLAST of HG10007084 vs. ExPASy TrEMBL
Match: A0A1S3BRX1 (nuclear transcription factor Y subunit B-4 OS=Cucumis melo OX=3656 GN=LOC103492518 PE=3 SV=1) HSP 1 Score: 191.8 bits (486), Expect = 1.7e-45 Identity = 94/119 (78.99%), Postives = 107/119 (89.92%), Query Frame = 0
BLAST of HG10007084 vs. ExPASy TrEMBL
Match: A0A6J1HDY6 (nuclear transcription factor Y subunit B-4-like OS=Cucurbita moschata OX=3662 GN=LOC111461996 PE=3 SV=1) HSP 1 Score: 175.3 bits (443), Expect = 1.6e-40 Identity = 87/119 (73.11%), Postives = 106/119 (89.08%), Query Frame = 0
BLAST of HG10007084 vs. ExPASy TrEMBL
Match: A0A6J1HUN8 (nuclear transcription factor Y subunit B-4-like OS=Cucurbita maxima OX=3661 GN=LOC111467987 PE=3 SV=1) HSP 1 Score: 174.5 bits (441), Expect = 2.7e-40 Identity = 87/122 (71.31%), Postives = 108/122 (88.52%), Query Frame = 0
BLAST of HG10007084 vs. TAIR 10
Match: AT1G09030.1 (nuclear factor Y, subunit B4 ) HSP 1 Score: 129.4 bits (324), Expect = 2.0e-30 Identity = 61/93 (65.59%), Postives = 77/93 (82.80%), Query Frame = 0
BLAST of HG10007084 vs. TAIR 10
Match: AT2G47810.1 (nuclear factor Y, subunit B5 ) HSP 1 Score: 122.9 bits (307), Expect = 1.8e-28 Identity = 57/94 (60.64%), Postives = 73/94 (77.66%), Query Frame = 0
BLAST of HG10007084 vs. TAIR 10
Match: AT5G47640.1 (nuclear factor Y, subunit B2 ) HSP 1 Score: 112.8 bits (281), Expect = 1.9e-25 Identity = 52/87 (59.77%), Postives = 67/87 (77.01%), Query Frame = 0
BLAST of HG10007084 vs. TAIR 10
Match: AT2G13570.1 (nuclear factor Y, subunit B7 ) HSP 1 Score: 111.3 bits (277), Expect = 5.5e-25 Identity = 56/118 (47.46%), Postives = 82/118 (69.49%), Query Frame = 0
BLAST of HG10007084 vs. TAIR 10
Match: AT4G14540.1 (nuclear factor Y, subunit B3 ) HSP 1 Score: 111.3 bits (277), Expect = 5.5e-25 Identity = 51/87 (58.62%), Postives = 67/87 (77.01%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Bottle gourd (Hangzhou Gourd) v1
Date Performed: 2022-08-01
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|