
HG10005984 (gene) Bottle gourd (Hangzhou Gourd) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: CDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGGATCCAGAGGCTGCACGAACCGCTCGAGAATCACTAGACCTTGCATTTCATATGTCTAACGTACTTGATGCTGGGATCGACCGCCACACCCTCTCTGTCCTCATTGCTCTTTGTGACATGGGTGTGAACCCTGAAGCACTGGCTGCTGTTGTCAAGGAACTACGCCGGGAGCCACCCTCATCGACCGTCGTCTCCAGTAACAAGTCATAA ATGGATCCAGAGGCTGCACGAACCGCTCGAGAATCACTAGACCTTGCATTTCATATGTCTAACGTACTTGATGCTGGGATCGACCGCCACACCCTCTCTGTCCTCATTGCTCTTTGTGACATGGGTGTGAACCCTGAAGCACTGGCTGCTGTTGTCAAGGAACTACGCCGGGAGCCACCCTCATCGACCGTCGTCTCCAGTAACAAGTCATAA ATGGATCCAGAGGCTGCACGAACCGCTCGAGAATCACTAGACCTTGCATTTCATATGTCTAACGTACTTGATGCTGGGATCGACCGCCACACCCTCTCTGTCCTCATTGCTCTTTGTGACATGGGTGTGAACCCTGAAGCACTGGCTGCTGTTGTCAAGGAACTACGCCGGGAGCCACCCTCATCGACCGTCGTCTCCAGTAACAAGTCATAA MDPEAARTARESLDLAFHMSNVLDAGIDRHTLSVLIALCDMGVNPEALAAVVKELRREPPSSTVVSSNKS Homology
BLAST of HG10005984 vs. NCBI nr
Match: XP_038889535.1 (mitotic-spindle organizing protein 1B [Benincasa hispida] >XP_038889536.1 mitotic-spindle organizing protein 1B [Benincasa hispida]) HSP 1 Score: 129.8 bits (325), Expect = 9.2e-27 Identity = 69/70 (98.57%), Postives = 69/70 (98.57%), Query Frame = 0
BLAST of HG10005984 vs. NCBI nr
Match: XP_011649034.1 (mitotic-spindle organizing protein 1A [Cucumis sativus]) HSP 1 Score: 127.9 bits (320), Expect = 3.5e-26 Identity = 68/71 (95.77%), Postives = 69/71 (97.18%), Query Frame = 0
BLAST of HG10005984 vs. NCBI nr
Match: XP_022973921.1 (mitotic-spindle organizing protein 1B-like [Cucurbita maxima] >XP_022973922.1 mitotic-spindle organizing protein 1B-like [Cucurbita maxima]) HSP 1 Score: 125.6 bits (314), Expect = 1.7e-25 Identity = 66/71 (92.96%), Postives = 67/71 (94.37%), Query Frame = 0
BLAST of HG10005984 vs. NCBI nr
Match: KAG6598967.1 (ALBINO3-like protein 3, mitochondrial, partial [Cucurbita argyrosperma subsp. sororia]) HSP 1 Score: 124.8 bits (312), Expect = 3.0e-25 Identity = 65/71 (91.55%), Postives = 67/71 (94.37%), Query Frame = 0
BLAST of HG10005984 vs. NCBI nr
Match: XP_008441751.1 (PREDICTED: mitotic-spindle organizing protein 1A-like [Cucumis melo] >XP_008441752.1 PREDICTED: mitotic-spindle organizing protein 1A-like [Cucumis melo] >XP_008441753.1 PREDICTED: mitotic-spindle organizing protein 1A-like [Cucumis melo] >XP_008441755.1 PREDICTED: mitotic-spindle organizing protein 1A-like [Cucumis melo] >XP_008441756.1 PREDICTED: mitotic-spindle organizing protein 1A-like [Cucumis melo] >XP_008441757.1 PREDICTED: mitotic-spindle organizing protein 1A-like [Cucumis melo]) HSP 1 Score: 124.4 bits (311), Expect = 3.9e-25 Identity = 67/71 (94.37%), Postives = 68/71 (95.77%), Query Frame = 0
BLAST of HG10005984 vs. ExPASy Swiss-Prot
Match: Q9M0N8 (Mitotic-spindle organizing protein 1B OS=Arabidopsis thaliana OX=3702 GN=GIP1 PE=1 SV=1) HSP 1 Score: 99.0 bits (245), Expect = 2.3e-20 Identity = 52/69 (75.36%), Postives = 57/69 (82.61%), Query Frame = 0
BLAST of HG10005984 vs. ExPASy Swiss-Prot
Match: Q9C9T3 (Mitotic-spindle organizing protein 1A OS=Arabidopsis thaliana OX=3702 GN=GIP2 PE=1 SV=1) HSP 1 Score: 92.0 bits (227), Expect = 2.8e-18 Identity = 44/63 (69.84%), Postives = 55/63 (87.30%), Query Frame = 0
BLAST of HG10005984 vs. ExPASy Swiss-Prot
Match: A9NKD9 (Mitotic-spindle organizing protein 1 OS=Picea sitchensis OX=3332 PE=3 SV=1) HSP 1 Score: 89.4 bits (220), Expect = 1.8e-17 Identity = 45/58 (77.59%), Postives = 50/58 (86.21%), Query Frame = 0
BLAST of HG10005984 vs. ExPASy Swiss-Prot
Match: B5FXZ4 (Mitotic-spindle organizing protein 1 OS=Taeniopygia guttata OX=59729 GN=mzt1 PE=3 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 5.3e-09 Identity = 24/48 (50.00%), Postives = 39/48 (81.25%), Query Frame = 0
BLAST of HG10005984 vs. ExPASy Swiss-Prot
Match: Q8BUR9 (Mitotic-spindle organizing protein 1 OS=Mus musculus OX=10090 GN=Mzt1 PE=1 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 2.0e-08 Identity = 27/60 (45.00%), Postives = 43/60 (71.67%), Query Frame = 0
BLAST of HG10005984 vs. ExPASy TrEMBL
Match: A0A0A0LMZ6 (Uncharacterized protein OS=Cucumis sativus OX=3659 GN=Csa_2G094370 PE=3 SV=1) HSP 1 Score: 127.9 bits (320), Expect = 1.7e-26 Identity = 68/71 (95.77%), Postives = 69/71 (97.18%), Query Frame = 0
BLAST of HG10005984 vs. ExPASy TrEMBL
Match: A0A6J1I8U7 (mitotic-spindle organizing protein 1B-like OS=Cucurbita maxima OX=3661 GN=LOC111472550 PE=3 SV=1) HSP 1 Score: 125.6 bits (314), Expect = 8.4e-26 Identity = 66/71 (92.96%), Postives = 67/71 (94.37%), Query Frame = 0
BLAST of HG10005984 vs. ExPASy TrEMBL
Match: A0A1S3B468 (mitotic-spindle organizing protein 1A-like OS=Cucumis melo OX=3656 GN=LOC103485818 PE=3 SV=1) HSP 1 Score: 124.4 bits (311), Expect = 1.9e-25 Identity = 67/71 (94.37%), Postives = 68/71 (95.77%), Query Frame = 0
BLAST of HG10005984 vs. ExPASy TrEMBL
Match: A0A7J8QTM5 (Uncharacterized protein OS=Gossypium davidsonii OX=34287 GN=Godav_017553 PE=3 SV=1) HSP 1 Score: 120.6 bits (301), Expect = 2.7e-24 Identity = 58/70 (82.86%), Postives = 67/70 (95.71%), Query Frame = 0
BLAST of HG10005984 vs. ExPASy TrEMBL
Match: A0A7J9LW57 (Uncharacterized protein (Fragment) OS=Gossypium schwendimanii OX=34291 GN=Goshw_013297 PE=3 SV=1) HSP 1 Score: 120.2 bits (300), Expect = 3.5e-24 Identity = 59/70 (84.29%), Postives = 66/70 (94.29%), Query Frame = 0
BLAST of HG10005984 vs. TAIR 10
Match: AT4G09550.1 (AtGCP3 interacting protein 1 ) HSP 1 Score: 99.0 bits (245), Expect = 1.6e-21 Identity = 52/69 (75.36%), Postives = 57/69 (82.61%), Query Frame = 0
BLAST of HG10005984 vs. TAIR 10
Match: AT1G73790.1 (Protein of unknown function (DUF3743) ) HSP 1 Score: 92.0 bits (227), Expect = 2.0e-19 Identity = 44/63 (69.84%), Postives = 55/63 (87.30%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Bottle gourd (Hangzhou Gourd) v1
Date Performed: 2022-08-01 Position : 0 Zoom : x 1
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|