Cmc09g0241431 (gene) Melon (Charmono) v1.1
Overview
Sequences
The following sequences are available for this feature:
Legend: exonCDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGATGCACAACAGGTTTGTGCAAGCTCTCATATGCACTTATTCTAACATTTTTGCATTTTTTGTCTTTGTTTGATGTATAATTCTTTTTATTGCAGAACCTACTGTGCTGAGATTGCTCATGATATTTCAACAAAGAAAAGGAAAGAGATTGTTGAGAGGGAAGCTCAACTTGATGTTGTAGTTGCCGACAAGCTGGCTAGGTTGCGTAGCCAAAGAAGATGA ATGATGCACAACAGAACCTACTGTGCTGAGATTGCTCATGATATTTCAACAAAGAAAAGGAAAGAGATTGTTGAGAGGGAAGCTCAACTTGATGTTGTAGTTGCCGACAAGCTGGCTAGGTTGCGTAGCCAAAGAAGATGA ATGATGCACAACAGAACCTACTGTGCTGAGATTGCTCATGATATTTCAACAAAGAAAAGGAAAGAGATTGTTGAGAGGGAAGCTCAACTTGATGTTGTAGTTGCCGACAAGCTGGCTAGGTTGCGTAGCCAAAGAAGATGA MMHNRTYCAEIAHDISTKKRKEIVEREAQLDVVVADKLARLRSQRR Homology
BLAST of Cmc09g0241431 vs. NCBI nr
Match: TYK01062.1 (60S ribosomal protein L32-1-like isoform X1 [Cucumis melo var. makuwa]) HSP 1 Score: 81.6 bits (200), Expect = 1.9e-12 Identity = 41/46 (89.13%), Postives = 44/46 (95.65%), Query Frame = 0
BLAST of Cmc09g0241431 vs. NCBI nr
Match: XP_022926464.1 (60S ribosomal protein L32-1-like [Cucurbita moschata] >XP_022926465.1 60S ribosomal protein L32-1-like [Cucurbita moschata] >XP_023003539.1 60S ribosomal protein L32-1-like [Cucurbita maxima] >XP_023003541.1 60S ribosomal protein L32-1-like [Cucurbita maxima] >XP_023517265.1 60S ribosomal protein L32-1-like [Cucurbita pepo subsp. pepo] >XP_023517267.1 60S ribosomal protein L32-1-like [Cucurbita pepo subsp. pepo]) HSP 1 Score: 80.9 bits (198), Expect = 3.2e-12 Identity = 40/44 (90.91%), Postives = 42/44 (95.45%), Query Frame = 0
BLAST of Cmc09g0241431 vs. NCBI nr
Match: KAA0057090.1 (60S ribosomal protein L32-1 [Cucumis melo var. makuwa] >TYK20625.1 60S ribosomal protein L32-1 [Cucumis melo var. makuwa]) HSP 1 Score: 80.9 bits (198), Expect = 3.2e-12 Identity = 40/44 (90.91%), Postives = 42/44 (95.45%), Query Frame = 0
BLAST of Cmc09g0241431 vs. NCBI nr
Match: XP_012473771.1 (PREDICTED: 60S ribosomal protein L32-1 [Gossypium raimondii] >XP_012490909.1 PREDICTED: 60S ribosomal protein L32-1 [Gossypium raimondii] >XP_016696230.1 60S ribosomal protein L32-1 [Gossypium hirsutum] >XP_016744931.1 60S ribosomal protein L32-1 [Gossypium hirsutum] >XP_017624736.1 PREDICTED: 60S ribosomal protein L32-1 [Gossypium arboreum] >XP_017626661.1 PREDICTED: 60S ribosomal protein L32-1 [Gossypium arboreum] >XP_017628208.1 PREDICTED: 60S ribosomal protein L32-1 [Gossypium arboreum] >XP_017639898.1 PREDICTED: 60S ribosomal protein L32-1 [Gossypium arboreum] >XP_017639904.1 PREDICTED: 60S ribosomal protein L32-1 [Gossypium arboreum] >XP_021273869.1 60S ribosomal protein L32-1 [Herrania umbratica] >XP_022727936.1 60S ribosomal protein L32-1 [Durio zibethinus] >XP_022758766.1 60S ribosomal protein L32-1 [Durio zibethinus] >XP_039027548.1 60S ribosomal protein L32-1-like [Hibiscus syriacus] >XP_040973569.1 60S ribosomal protein L32-1 [Gossypium hirsutum] >XP_040973570.1 60S ribosomal protein L32-1 [Gossypium hirsutum] >XP_040973571.1 60S ribosomal protein L32-1 [Gossypium hirsutum] >XP_040973572.1 60S ribosomal protein L32-1 [Gossypium hirsutum] >KAB2003792.1 hypothetical protein ES319_D11G154700v1 [Gossypium barbadense] >KAG8477876.1 hypothetical protein CXB51_027533 [Gossypium anomalum] >MBA0686357.1 hypothetical protein [Gossypium aridum] >MBA0769781.1 hypothetical protein [Gossypium trilobum] >MBA0802743.1 hypothetical protein [Gossypium harknessii] >MBA0859198.1 hypothetical protein [Gossypium schwendimanii] >TYG45308.1 hypothetical protein ES288_D11G163100v1 [Gossypium darwinii] >TYH43952.1 hypothetical protein ES332_D11G160600v1 [Gossypium tomentosum] >TYI55692.1 hypothetical protein E1A91_D11G158200v1 [Gossypium mustelinum]) HSP 1 Score: 80.9 bits (198), Expect = 3.2e-12 Identity = 40/44 (90.91%), Postives = 42/44 (95.45%), Query Frame = 0
BLAST of Cmc09g0241431 vs. NCBI nr
Match: MBA0615238.1 (hypothetical protein [Gossypium davidsonii]) HSP 1 Score: 80.9 bits (198), Expect = 3.2e-12 Identity = 40/44 (90.91%), Postives = 42/44 (95.45%), Query Frame = 0
BLAST of Cmc09g0241431 vs. ExPASy Swiss-Prot
Match: Q9FHG2 (60S ribosomal protein L32-2 OS=Arabidopsis thaliana OX=3702 GN=RPL32B PE=2 SV=1) HSP 1 Score: 74.7 bits (182), Expect = 3.0e-13 Identity = 37/44 (84.09%), Postives = 41/44 (93.18%), Query Frame = 0
BLAST of Cmc09g0241431 vs. ExPASy Swiss-Prot
Match: P49211 (60S ribosomal protein L32-1 OS=Arabidopsis thaliana OX=3702 GN=RPL32A PE=2 SV=2) HSP 1 Score: 74.3 bits (181), Expect = 4.0e-13 Identity = 36/44 (81.82%), Postives = 41/44 (93.18%), Query Frame = 0
BLAST of Cmc09g0241431 vs. ExPASy Swiss-Prot
Match: P51421 (60S ribosomal protein L32 (Fragment) OS=Zea mays OX=4577 GN=RPL32 PE=2 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 2.7e-09 Identity = 31/39 (79.49%), Postives = 34/39 (87.18%), Query Frame = 0
BLAST of Cmc09g0241431 vs. ExPASy Swiss-Prot
Match: Q962T1 (60S ribosomal protein L32 OS=Spodoptera frugiperda OX=7108 GN=RpL32 PE=2 SV=1) HSP 1 Score: 57.8 bits (138), Expect = 3.8e-08 Identity = 29/44 (65.91%), Postives = 33/44 (75.00%), Query Frame = 0
BLAST of Cmc09g0241431 vs. ExPASy Swiss-Prot
Match: P04359 (60S ribosomal protein L32 OS=Drosophila melanogaster OX=7227 GN=RpL32 PE=1 SV=3) HSP 1 Score: 54.3 bits (129), Expect = 4.2e-07 Identity = 27/44 (61.36%), Postives = 32/44 (72.73%), Query Frame = 0
BLAST of Cmc09g0241431 vs. ExPASy TrEMBL
Match: A0A5D3BQL3 (60S ribosomal protein L32-1-like isoform X1 OS=Cucumis melo var. makuwa OX=1194695 GN=E5676_scaffold264G00760 PE=3 SV=1) HSP 1 Score: 81.6 bits (200), Expect = 9.1e-13 Identity = 41/46 (89.13%), Postives = 44/46 (95.65%), Query Frame = 0
BLAST of Cmc09g0241431 vs. ExPASy TrEMBL
Match: A0A6J1KGP3 (60S ribosomal protein L32-1 OS=Cucurbita maxima OX=3661 GN=LOC111495610 PE=3 SV=1) HSP 1 Score: 80.9 bits (198), Expect = 1.6e-12 Identity = 40/44 (90.91%), Postives = 42/44 (95.45%), Query Frame = 0
BLAST of Cmc09g0241431 vs. ExPASy TrEMBL
Match: A0A1U8K133 (60S ribosomal protein L32-1 OS=Gossypium hirsutum OX=3635 GN=LOC107912532 PE=3 SV=1) HSP 1 Score: 80.9 bits (198), Expect = 1.6e-12 Identity = 40/44 (90.91%), Postives = 42/44 (95.45%), Query Frame = 0
BLAST of Cmc09g0241431 vs. ExPASy TrEMBL
Match: A0A6J1KPI9 (60S ribosomal protein L32-1-like OS=Cucurbita maxima OX=3661 GN=LOC111497112 PE=3 SV=1) HSP 1 Score: 80.9 bits (198), Expect = 1.6e-12 Identity = 40/44 (90.91%), Postives = 42/44 (95.45%), Query Frame = 0
BLAST of Cmc09g0241431 vs. ExPASy TrEMBL
Match: A0A5D2FU43 (Uncharacterized protein OS=Gossypium darwinii OX=34276 GN=ES288_A07G106200v1 PE=3 SV=1) HSP 1 Score: 80.9 bits (198), Expect = 1.6e-12 Identity = 40/44 (90.91%), Postives = 42/44 (95.45%), Query Frame = 0
BLAST of Cmc09g0241431 vs. TAIR 10
Match: AT5G46430.1 (Ribosomal protein L32e ) HSP 1 Score: 74.7 bits (182), Expect = 2.1e-14 Identity = 37/44 (84.09%), Postives = 41/44 (93.18%), Query Frame = 0
BLAST of Cmc09g0241431 vs. TAIR 10
Match: AT5G46430.2 (Ribosomal protein L32e ) HSP 1 Score: 74.7 bits (182), Expect = 2.1e-14 Identity = 37/44 (84.09%), Postives = 41/44 (93.18%), Query Frame = 0
BLAST of Cmc09g0241431 vs. TAIR 10
Match: AT4G18100.1 (Ribosomal protein L32e ) HSP 1 Score: 74.3 bits (181), Expect = 2.8e-14 Identity = 36/44 (81.82%), Postives = 41/44 (93.18%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Melon (Charmono) v1.1
Date Performed: 2022-10-13
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|