Clc09G10890 (gene) Watermelon (cordophanus) v2
Overview
Sequences
The following sequences are available for this feature:
Legend: exonCDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCTCTGATGGGTGGTTTTGCTAGAATAGGCAATAATGAGGTCACTATTTTAGTAAATGATGGGGAGAAGGCCAGTGACATTGATCCACAAGAAGCTCAACAAACTCTTGAAATAGCGGAAGCTAACTTGAGGAAAGCTCAGGGCAAGAGACAAGCAATCGAGGCAAATTTCGCTCTCAGGCAAGCTAGGACACGAGTAGAGGCTATCAATGGCGTACCTAGTTAA ATGGCTCTGATGGGTGGTTTTGCTAGAATAGGCAATAATGAGGTCACTATTTTAGTAAATGATGGGGAGAAGGCCAGTGACATTGATCCACAAGAAGCTCAACAAACTCTTGAAATAGCGGAAGCTAACTTGAGGAAAGCTCAGGGCAAGAGACAAGCAATCGAGGCAAATTTCGCTCTCAGGCAAGCTAGGACACGAGTAGAGGCTATCAATGGCGTACCTAGTTAA ATGGCTCTGATGGGTGGTTTTGCTAGAATAGGCAATAATGAGGTCACTATTTTAGTAAATGATGGGGAGAAGGCCAGTGACATTGATCCACAAGAAGCTCAACAAACTCTTGAAATAGCGGAAGCTAACTTGAGGAAAGCTCAGGGCAAGAGACAAGCAATCGAGGCAAATTTCGCTCTCAGGCAAGCTAGGACACGAGTAGAGGCTATCAATGGCGTACCTAGTTAA MALMGGFARIGNNEVTILVNDGEKASDIDPQEAQQTLEIAEANLRKAQGKRQAIEANFALRQARTRVEAINGVPS Homology
BLAST of Clc09G10890 vs. NCBI nr
Match: YP_009752081.1 (CF1 subunit epsilon [Dendrosicyos socotranus] >YP_009753095.1 CF1 subunit epsilon [Corallocarpus boehmii] >QIT05491.1 CF1 subunit epsilon [Dendrosicyos socotranus] >QIT06167.1 CF1 subunit epsilon [Corallocarpus boehmii]) HSP 1 Score: 134.4 bits (337), Expect = 4.0e-28 Identity = 71/75 (94.67%), Postives = 72/75 (96.00%), Query Frame = 0
BLAST of Clc09G10890 vs. NCBI nr
Match: ASY96329.1 (ATP synthase CF1 epsilon subunit [Cucumis melo subsp. agrestis]) HSP 1 Score: 134.4 bits (337), Expect = 4.0e-28 Identity = 71/75 (94.67%), Postives = 72/75 (96.00%), Query Frame = 0
BLAST of Clc09G10890 vs. NCBI nr
Match: ALO22128.1 (AtpE [Cucurbita ficifolia] >QWV60846.1 ATP synthase CF1 epsilon subunit [Cucurbita ficifolia] >QZL38791.1 ATP synthase CF1 epsilon subunit [Cucurbita ficifolia]) HSP 1 Score: 134.4 bits (337), Expect = 4.0e-28 Identity = 71/75 (94.67%), Postives = 72/75 (96.00%), Query Frame = 0
BLAST of Clc09G10890 vs. NCBI nr
Match: YP_004841789.1 (ATP synthase CF1 epsilon subunit [Cucumis melo subsp. melo] >YP_009004050.1 ATP synthase CF1 epsilon subunit [Cucumis hystrix] >YP_009317392.1 ATP synthase CF1 epsilon subunit [Coccinia grandis] >YP_009325995.1 ATP synthase CF1 epsilon subunit [Citrullus lanatus] >YP_009348037.1 ATP synthase CF1 epsilon subunit [Citrullus mucosospermus] >YP_009420800.1 ATP synthase CF1 epsilon subunit [Citrullus colocynthis] >YP_009431563.1 ATP synthase CF1 epsilon subunit [Citrullus amarus] >YP_009431648.1 ATP synthase CF1 epsilon subunit [Citrullus rehmii] >YP_009456152.1 ATP synthase CF1 epsilon subunit [Lagenaria siceraria] >YP_009860079.1 ATP synthase CF1 epsilon subunit [Cucumis melo subsp. agrestis] >YP_247605.1 ATP synthase CF1 epsilon subunit [Cucumis sativus] >Q4VZG9.1 RecName: Full=ATP synthase epsilon chain, chloroplastic; AltName: Full=ATP synthase F1 sector epsilon subunit; AltName: Full=F-ATPase epsilon subunit [Cucumis sativus] >ALF03307.1 ATP synthase CF1 epsilon subunit [Cucumis sativus var. hardwickii] >APW82467.1 ATP synthase CF1 epsilon subunit [Citrullus lanatus subsp. vulgaris] >ASY96590.1 ATP synthase CF1 epsilon subunit [Cucumis melo var. conomon] >ASY96677.1 ATP synthase CF1 epsilon subunit [Cucumis melo var. makuwa] >ASY96764.1 ATP synthase CF1 epsilon subunit [Cucumis melo var. momordica] >ASY96851.1 ATP synthase CF1 epsilon subunit [Cucumis melo var. dudaim] >ASY96938.1 ATP synthase CF1 epsilon subunit [Cucumis melo var. cantalupo] >ASY97112.1 ATP synthase CF1 epsilon subunit [Cucumis melo var. inodorus] >ASY97286.1 ATP synthase CF1 epsilon subunit [Cucumis melo var. flexuosus] >AVE15337.1 AtpE [Cucumis sativus var. sativus] >QJF46389.1 ATP synthase CF1 epsilon subunit [Cucumis melo] >QNM38537.1 ATP synthase CF1 epsilon subunit [Lagenaria siceraria var. microcarpa] >QZL38599.1 CF1 subunit epsilon [Citrullus naudinianus] >QZL38687.1 CF1 subunit epsilon [Citrullus ecirrhosus]) HSP 1 Score: 134.4 bits (337), Expect = 4.0e-28 Identity = 71/75 (94.67%), Postives = 72/75 (96.00%), Query Frame = 0
BLAST of Clc09G10890 vs. NCBI nr
Match: MBC9853674.1 (hypothetical protein [Adiantum capillus-veneris]) HSP 1 Score: 134.4 bits (337), Expect = 4.0e-28 Identity = 71/75 (94.67%), Postives = 72/75 (96.00%), Query Frame = 0
BLAST of Clc09G10890 vs. ExPASy Swiss-Prot
Match: Q4VZG9 (ATP synthase epsilon chain, chloroplastic OS=Cucumis sativus OX=3659 GN=atpE PE=3 SV=1) HSP 1 Score: 134.4 bits (337), Expect = 5.2e-31 Identity = 71/75 (94.67%), Postives = 72/75 (96.00%), Query Frame = 0
BLAST of Clc09G10890 vs. ExPASy Swiss-Prot
Match: Q49KZ2 (ATP synthase epsilon chain, chloroplastic OS=Eucalyptus globulus subsp. globulus OX=71271 GN=atpE PE=3 SV=1) HSP 1 Score: 122.5 bits (306), Expect = 2.1e-27 Identity = 62/73 (84.93%), Postives = 68/73 (93.15%), Query Frame = 0
BLAST of Clc09G10890 vs. ExPASy Swiss-Prot
Match: A0ZZ41 (ATP synthase epsilon chain, chloroplastic OS=Gossypium barbadense OX=3634 GN=atpE PE=3 SV=1) HSP 1 Score: 122.5 bits (306), Expect = 2.1e-27 Identity = 63/73 (86.30%), Postives = 67/73 (91.78%), Query Frame = 0
BLAST of Clc09G10890 vs. ExPASy Swiss-Prot
Match: Q2L911 (ATP synthase epsilon chain, chloroplastic OS=Gossypium hirsutum OX=3635 GN=atpE PE=3 SV=1) HSP 1 Score: 122.5 bits (306), Expect = 2.1e-27 Identity = 63/73 (86.30%), Postives = 67/73 (91.78%), Query Frame = 0
BLAST of Clc09G10890 vs. ExPASy Swiss-Prot
Match: Q70XZ7 (ATP synthase epsilon chain, chloroplastic OS=Amborella trichopoda OX=13333 GN=atpE PE=3 SV=1) HSP 1 Score: 122.1 bits (305), Expect = 2.7e-27 Identity = 63/75 (84.00%), Postives = 68/75 (90.67%), Query Frame = 0
BLAST of Clc09G10890 vs. ExPASy TrEMBL
Match: A0A218KG49 (ATP synthase epsilon chain, chloroplastic OS=Cucumis sativus var. hardwickii OX=319220 GN=atpE PE=3 SV=1) HSP 1 Score: 134.4 bits (337), Expect = 1.9e-28 Identity = 71/75 (94.67%), Postives = 72/75 (96.00%), Query Frame = 0
BLAST of Clc09G10890 vs. ExPASy TrEMBL
Match: G3ETZ1 (ATP synthase epsilon chain, chloroplastic OS=Cucumis melo subsp. melo OX=412675 GN=atpE PE=3 SV=1) HSP 1 Score: 134.4 bits (337), Expect = 1.9e-28 Identity = 71/75 (94.67%), Postives = 72/75 (96.00%), Query Frame = 0
BLAST of Clc09G10890 vs. ExPASy TrEMBL
Match: A0A1X9Q1L0 (ATP synthase epsilon chain, chloroplastic OS=Cucumis sativus OX=3659 GN=atpE PE=3 SV=1) HSP 1 Score: 134.4 bits (337), Expect = 1.9e-28 Identity = 71/75 (94.67%), Postives = 72/75 (96.00%), Query Frame = 0
BLAST of Clc09G10890 vs. ExPASy TrEMBL
Match: A0A249RZA2 (ATP synthase epsilon chain, chloroplastic OS=Cucumis melo var. cantalupensis OX=3658 GN=atpE PE=3 SV=1) HSP 1 Score: 134.4 bits (337), Expect = 1.9e-28 Identity = 71/75 (94.67%), Postives = 72/75 (96.00%), Query Frame = 0
BLAST of Clc09G10890 vs. ExPASy TrEMBL
Match: A0A1S4EU14 (ATP synthase epsilon chain, chloroplastic OS=Cucumis melo OX=3656 GN=atpE PE=3 SV=1) HSP 1 Score: 134.4 bits (337), Expect = 1.9e-28 Identity = 71/75 (94.67%), Postives = 72/75 (96.00%), Query Frame = 0
BLAST of Clc09G10890 vs. TAIR 10
Match: ATCG00470.1 (ATP synthase epsilon chain ) HSP 1 Score: 122.1 bits (305), Expect = 1.9e-28 Identity = 63/73 (86.30%), Postives = 68/73 (93.15%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Watermelon (cordophanus) v2
Date Performed: 2022-01-31
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|