
Chy6G112460 (gene) Cucumber (hystrix) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: exonCDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGAACCAAGATTCTCGCCGCGCCACCAATCATCCTCCACCTCCAATTGTGAAGCTTGAATCTACAGATGATCGCAAACCCTCATCTCCCGCTCCCCTCTCCAAGAAAATCGTCATCAAGAGCGCCGATATGTTCACTGACATGCAGAAGGAGGCTATTGACACTGCCATAGCCGTCAGTGCTTCTACCTCCCTCTTCTTCTCTTTATTTTTCTCTTTTCATTCCTTCATAATCTCTTTCGTTTTTAGGCATTTGAGAAACATTCCGTTGAGAAGGATATTGCCGAACAGATAAAGAAAGAGTTTGATAAGAATCATGGACCCACCTGGCATTGCATCGTCGGTCGTAATTTTGGTACCTTCTTTCACTCTCTATCTCTATTTCTTTACCTTCCTGCTTCATTTTCGCTTTCTTTCACTCTGATGTACTGAATCTCTGTTCATTTCTCTAACTTTATGCTCTCTTTGGAAATGCTTCTCTTAATTCAACTTCAATCTACGGAAATTGAGATCTAGCTGTTTGTTTATTTTTTTTTTCCCGGTGAACAATTAGATGGAGATTGGAGTAGGATGTTTTTCTTCGGGATTCTGATACCGTTAGCTTGGTTATTCTTTCAGGCTCTACCACTAAGCAGAAGCAAGATTTGTCTGCATAG ATGAACCAAGATTCTCGCCGCGCCACCAATCATCCTCCACCTCCAATTGTGAAGCTTGAATCTACAGATGATCGCAAACCCTCATCTCCCGCTCCCCTCTCCAAGAAAATCGTCATCAAGAGCGCCGATATGTTCACTGACATGCAGAAGGAGGCTATTGACACTGCCATAGCCGCATTTGAGAAACATTCCGTTGAGAAGGATATTGCCGAACAGATAAAGAAAGAGTTTGATAAGAATCATGGACCCACCTGGCATTGCATCGTCGGTCGCTCTACCACTAAGCAGAAGCAAGATTTGTCTGCATAG ATGAACCAAGATTCTCGCCGCGCCACCAATCATCCTCCACCTCCAATTGTGAAGCTTGAATCTACAGATGATCGCAAACCCTCATCTCCCGCTCCCCTCTCCAAGAAAATCGTCATCAAGAGCGCCGATATGTTCACTGACATGCAGAAGGAGGCTATTGACACTGCCATAGCCGCATTTGAGAAACATTCCGTTGAGAAGGATATTGCCGAACAGATAAAGAAAGAGTTTGATAAGAATCATGGACCCACCTGGCATTGCATCGTCGGTCGCTCTACCACTAAGCAGAAGCAAGATTTGTCTGCATAG MNQDSRRATNHPPPPIVKLESTDDRKPSSPAPLSKKIVIKSADMFTDMQKEAIDTAIAAFEKHSVEKDIAEQIKKEFDKNHGPTWHCIVGRSTTKQKQDLSA* Homology
BLAST of Chy6G112460 vs. ExPASy Swiss-Prot
Match: Q22799 (Dynein light chain 1, cytoplasmic OS=Caenorhabditis elegans OX=6239 GN=dlc-1 PE=1 SV=1) HSP 1 Score: 83.2 bits (204), Expect = 1.9e-15 Identity = 38/60 (63.33%), Postives = 48/60 (80.00%), Query Frame = 0
BLAST of Chy6G112460 vs. ExPASy Swiss-Prot
Match: Q3MHR3 (Dynein light chain 2, cytoplasmic OS=Bos taurus OX=9913 GN=DYNLL2 PE=3 SV=1) HSP 1 Score: 82.4 bits (202), Expect = 3.2e-15 Identity = 37/58 (63.79%), Postives = 47/58 (81.03%), Query Frame = 0
BLAST of Chy6G112460 vs. ExPASy Swiss-Prot
Match: Q96FJ2 (Dynein light chain 2, cytoplasmic OS=Homo sapiens OX=9606 GN=DYNLL2 PE=1 SV=1) HSP 1 Score: 82.4 bits (202), Expect = 3.2e-15 Identity = 37/58 (63.79%), Postives = 47/58 (81.03%), Query Frame = 0
BLAST of Chy6G112460 vs. ExPASy Swiss-Prot
Match: Q9D0M5 (Dynein light chain 2, cytoplasmic OS=Mus musculus OX=10090 GN=Dynll2 PE=1 SV=1) HSP 1 Score: 82.4 bits (202), Expect = 3.2e-15 Identity = 37/58 (63.79%), Postives = 47/58 (81.03%), Query Frame = 0
BLAST of Chy6G112460 vs. ExPASy Swiss-Prot
Match: Q78P75 (Dynein light chain 2, cytoplasmic OS=Rattus norvegicus OX=10116 GN=Dynll2 PE=1 SV=1) HSP 1 Score: 82.4 bits (202), Expect = 3.2e-15 Identity = 37/58 (63.79%), Postives = 47/58 (81.03%), Query Frame = 0
BLAST of Chy6G112460 vs. ExPASy TrEMBL
Match: A0A0A0LAM1 (Dynein light chain OS=Cucumis sativus OX=3659 GN=Csa_3G159460 PE=3 SV=1) HSP 1 Score: 182.2 bits (461), Expect = 1.1e-42 Identity = 90/92 (97.83%), Postives = 91/92 (98.91%), Query Frame = 0
BLAST of Chy6G112460 vs. ExPASy TrEMBL
Match: A0A5D3CY39 (Dynein light chain OS=Cucumis melo var. makuwa OX=1194695 GN=E5676_scaffold209G001160 PE=3 SV=1) HSP 1 Score: 172.2 bits (435), Expect = 1.2e-39 Identity = 85/98 (86.73%), Postives = 89/98 (90.82%), Query Frame = 0
BLAST of Chy6G112460 vs. ExPASy TrEMBL
Match: A0A1S4DSP2 (Dynein light chain OS=Cucumis melo OX=3656 GN=LOC103483858 PE=3 SV=1) HSP 1 Score: 170.2 bits (430), Expect = 4.4e-39 Identity = 84/92 (91.30%), Postives = 87/92 (94.57%), Query Frame = 0
BLAST of Chy6G112460 vs. ExPASy TrEMBL
Match: A0A6J1G0U9 (Dynein light chain OS=Cucurbita moschata OX=3662 GN=LOC111449637 PE=3 SV=1) HSP 1 Score: 134.4 bits (337), Expect = 2.7e-28 Identity = 69/92 (75.00%), Postives = 80/92 (86.96%), Query Frame = 0
BLAST of Chy6G112460 vs. ExPASy TrEMBL
Match: A0A6J1I9I2 (Dynein light chain OS=Cucurbita maxima OX=3661 GN=LOC111472324 PE=3 SV=1) HSP 1 Score: 132.9 bits (333), Expect = 7.7e-28 Identity = 69/95 (72.63%), Postives = 79/95 (83.16%), Query Frame = 0
BLAST of Chy6G112460 vs. NCBI nr
Match: XP_004134221.1 (dynein light chain 1, cytoplasmic [Cucumis sativus] >KGN57126.1 hypothetical protein Csa_011724 [Cucumis sativus]) HSP 1 Score: 185 bits (469), Expect = 2.74e-58 Identity = 90/92 (97.83%), Postives = 91/92 (98.91%), Query Frame = 0
BLAST of Chy6G112460 vs. NCBI nr
Match: KAA0049508.1 (dynein light chain 1 [Cucumis melo var. makuwa] >TYK16188.1 dynein light chain 1 [Cucumis melo var. makuwa]) HSP 1 Score: 174 bits (442), Expect = 7.20e-54 Identity = 85/98 (86.73%), Postives = 89/98 (90.82%), Query Frame = 0
BLAST of Chy6G112460 vs. NCBI nr
Match: XP_016898981.1 (PREDICTED: dynein light chain 1, cytoplasmic-like [Cucumis melo] >XP_016898982.1 PREDICTED: dynein light chain 1, cytoplasmic-like [Cucumis melo] >XP_016898983.1 PREDICTED: dynein light chain 1, cytoplasmic-like [Cucumis melo]) HSP 1 Score: 173 bits (438), Expect = 1.46e-53 Identity = 84/92 (91.30%), Postives = 87/92 (94.57%), Query Frame = 0
BLAST of Chy6G112460 vs. NCBI nr
Match: XP_038904701.1 (dynein light chain 1, cytoplasmic-like [Benincasa hispida]) HSP 1 Score: 144 bits (362), Expect = 5.05e-42 Identity = 75/92 (81.52%), Postives = 83/92 (90.22%), Query Frame = 0
BLAST of Chy6G112460 vs. NCBI nr
Match: KAG7028990.1 (Dynein light chain 1, cytoplasmic [Cucurbita argyrosperma subsp. argyrosperma]) HSP 1 Score: 137 bits (345), Expect = 1.07e-39 Identity = 69/92 (75.00%), Postives = 80/92 (86.96%), Query Frame = 0
BLAST of Chy6G112460 vs. TAIR 10
Match: AT4G15930.1 (Dynein light chain type 1 family protein ) HSP 1 Score: 99.8 bits (247), Expect = 1.4e-21 Identity = 52/75 (69.33%), Postives = 58/75 (77.33%), Query Frame = 0
BLAST of Chy6G112460 vs. TAIR 10
Match: AT5G20110.1 (Dynein light chain type 1 family protein ) HSP 1 Score: 46.2 bits (108), Expect = 1.8e-05 Identity = 28/57 (49.12%), Postives = 34/57 (59.65%), Query Frame = 0
BLAST of Chy6G112460 vs. TAIR 10
Match: AT1G52240.2 (RHO guanyl-nucleotide exchange factor 11 ) HSP 1 Score: 43.1 bits (100), Expect = 1.6e-04 Identity = 24/60 (40.00%), Postives = 34/60 (56.67%), Query Frame = 0
BLAST of Chy6G112460 vs. TAIR 10
Match: AT4G27360.1 (Dynein light chain type 1 family protein ) HSP 1 Score: 42.4 bits (98), Expect = 2.6e-04 Identity = 24/60 (40.00%), Postives = 34/60 (56.67%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Cucumber (hystrix) v1
Date Performed: 2021-10-25 Position : 0 Zoom : x 1
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|