CcUC05G109230 (gene) Watermelon (PI 537277) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: exonCDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGGTACGTTGCTTCAACTTAGTGTCCGTTTTCGTCCTCGCCGCCGTTGCGGTTTCCATGATCGTTCTGCCCTTGGTTCTTCCGCCGCTGCCTCCGCCACCGCTTGTGTTTCTCTTCTTTCCAGTTGGAATCATGGCGGCGCTTCTTCTCCTCGCTTTTTCCCCCTCCGATGTCGGCGCCGGGAACGTCTTTGTATGA ATGGTACGTTGCTTCAACTTAGTGTCCGTTTTCGTCCTCGCCGCCGTTGCGGTTTCCATGATCGTTCTGCCCTTGGTTCTTCCGCCGCTGCCTCCGCCACCGCTTGTGTTTCTCTTCTTTCCAGTTGGAATCATGGCGGCGCTTCTTCTCCTCGCTTTTTCCCCCTCCGATGTCGGCGCCGGGAACGTCTTTGTATGA ATGGTACGTTGCTTCAACTTAGTGTCCGTTTTCGTCCTCGCCGCCGTTGCGGTTTCCATGATCGTTCTGCCCTTGGTTCTTCCGCCGCTGCCTCCGCCACCGCTTGTGTTTCTCTTCTTTCCAGTTGGAATCATGGCGGCGCTTCTTCTCCTCGCTTTTTCCCCCTCCGATGTCGGCGCCGGGAACGTCTTTGTATGA MVRCFNLVSVFVLAAVAVSMIVLPLVLPPLPPPPLVFLFFPVGIMAALLLLAFSPSDVGAGNVFV Homology
BLAST of CcUC05G109230 vs. NCBI nr
Match: KAG6601123.1 (Transcription factor IIIA, partial [Cucurbita argyrosperma subsp. sororia]) HSP 1 Score: 98.2 bits (243), Expect = 2.8e-17 Identity = 53/62 (85.48%), Postives = 58/62 (93.55%), Query Frame = 0
BLAST of CcUC05G109230 vs. NCBI nr
Match: XP_007148923.1 (hypothetical protein PHAVU_005G025500g [Phaseolus vulgaris] >ESW20917.1 hypothetical protein PHAVU_005G025500g [Phaseolus vulgaris]) HSP 1 Score: 87.0 bits (214), Expect = 6.3e-14 Identity = 50/64 (78.12%), Postives = 57/64 (89.06%), Query Frame = 0
BLAST of CcUC05G109230 vs. NCBI nr
Match: KAG2372512.1 (uncharacterized protein HKW66_Vig0206190 [Vigna angularis] >KOM42438.1 hypothetical protein LR48_Vigan05g004200 [Vigna angularis] >BAT93370.1 hypothetical protein VIGAN_07232000 [Vigna angularis var. angularis]) HSP 1 Score: 87.0 bits (214), Expect = 6.3e-14 Identity = 50/64 (78.12%), Postives = 57/64 (89.06%), Query Frame = 0
BLAST of CcUC05G109230 vs. NCBI nr
Match: KAF5742459.1 (putative transmembrane protein [Tripterygium wilfordii]) HSP 1 Score: 87.0 bits (214), Expect = 6.3e-14 Identity = 47/65 (72.31%), Postives = 55/65 (84.62%), Query Frame = 0
BLAST of CcUC05G109230 vs. NCBI nr
Match: RZB80655.1 (hypothetical protein D0Y65_030376 [Glycine soja]) HSP 1 Score: 84.7 bits (208), Expect = 3.2e-13 Identity = 47/57 (82.46%), Postives = 51/57 (89.47%), Query Frame = 0
BLAST of CcUC05G109230 vs. ExPASy Swiss-Prot
Match: Q6NMD6 (Protein AUXIN-REGULATED GENE INVOLVED IN ORGAN SIZE OS=Arabidopsis thaliana OX=3702 GN=ARGOS PE=2 SV=1) HSP 1 Score: 56.6 bits (135), Expect = 1.2e-07 Identity = 31/61 (50.82%), Postives = 42/61 (68.85%), Query Frame = 0
BLAST of CcUC05G109230 vs. ExPASy Swiss-Prot
Match: C7SFP6 (Protein AUXIN-REGULATED GENE INVOLVED IN ORGAN SIZE OS=Brassica rapa subsp. pekinensis OX=51351 GN=ARGOS PE=2 SV=2) HSP 1 Score: 55.1 bits (131), Expect = 3.5e-07 Identity = 28/52 (53.85%), Postives = 39/52 (75.00%), Query Frame = 0
BLAST of CcUC05G109230 vs. ExPASy Swiss-Prot
Match: Q8RXL7 (ARGOS-like protein OS=Arabidopsis thaliana OX=3702 GN=ARL PE=2 SV=1) HSP 1 Score: 55.1 bits (131), Expect = 3.5e-07 Identity = 28/52 (53.85%), Postives = 39/52 (75.00%), Query Frame = 0
BLAST of CcUC05G109230 vs. ExPASy Swiss-Prot
Match: Q7X6L2 (Protein AUXIN-REGULATED GENE INVOLVED IN ORGAN SIZE OS=Oryza sativa subsp. japonica OX=39947 GN=ARGOS PE=2 SV=1) HSP 1 Score: 48.5 bits (114), Expect = 3.3e-05 Identity = 25/58 (43.10%), Postives = 39/58 (67.24%), Query Frame = 0
BLAST of CcUC05G109230 vs. ExPASy TrEMBL
Match: A0A7J7D881 (Putative transmembrane protein OS=Tripterygium wilfordii OX=458696 GN=HS088_TW09G00507 PE=4 SV=1) HSP 1 Score: 87.0 bits (214), Expect = 3.1e-14 Identity = 47/65 (72.31%), Postives = 55/65 (84.62%), Query Frame = 0
BLAST of CcUC05G109230 vs. ExPASy TrEMBL
Match: A0A0L9UI81 (Uncharacterized protein OS=Phaseolus angularis OX=3914 GN=LR48_Vigan05g004200 PE=4 SV=1) HSP 1 Score: 87.0 bits (214), Expect = 3.1e-14 Identity = 50/64 (78.12%), Postives = 57/64 (89.06%), Query Frame = 0
BLAST of CcUC05G109230 vs. ExPASy TrEMBL
Match: A0A0S3SKI1 (Uncharacterized protein OS=Vigna angularis var. angularis OX=157739 GN=Vigan.07G232000 PE=4 SV=1) HSP 1 Score: 87.0 bits (214), Expect = 3.1e-14 Identity = 50/64 (78.12%), Postives = 57/64 (89.06%), Query Frame = 0
BLAST of CcUC05G109230 vs. ExPASy TrEMBL
Match: V7BSD6 (Uncharacterized protein OS=Phaseolus vulgaris OX=3885 GN=PHAVU_005G025500g PE=4 SV=1) HSP 1 Score: 87.0 bits (214), Expect = 3.1e-14 Identity = 50/64 (78.12%), Postives = 57/64 (89.06%), Query Frame = 0
BLAST of CcUC05G109230 vs. ExPASy TrEMBL
Match: K7K5P8 (Uncharacterized protein OS=Glycine max OX=3847 GN=GLYMA_11G156100 PE=4 SV=1) HSP 1 Score: 84.7 bits (208), Expect = 1.5e-13 Identity = 47/57 (82.46%), Postives = 51/57 (89.47%), Query Frame = 0
BLAST of CcUC05G109230 vs. TAIR 10
Match: AT3G59900.1 (auxin-regulated gene involved in organ size ) HSP 1 Score: 56.6 bits (135), Expect = 8.6e-09 Identity = 31/61 (50.82%), Postives = 42/61 (68.85%), Query Frame = 0
BLAST of CcUC05G109230 vs. TAIR 10
Match: AT2G44080.1 (ARGOS-like ) HSP 1 Score: 55.1 bits (131), Expect = 2.5e-08 Identity = 28/52 (53.85%), Postives = 39/52 (75.00%), Query Frame = 0
BLAST of CcUC05G109230 vs. TAIR 10
Match: AT2G41230.1 (unknown protein; Has 75 Blast hits to 75 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 75; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). ) HSP 1 Score: 40.8 bits (94), Expect = 4.9e-04 Identity = 23/49 (46.94%), Postives = 34/49 (69.39%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Watermelon (PI 537277) v1
Date Performed: 2022-01-31
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|