![](http://cucurbitgenomics.org/sites/default/files/styles/slideshow/public/carousel/101322_web.jpg?itok=EG-G51x6)
Carg05359 (gene) Silver-seed gourd (SMH-JMG-627) v2
Overview
Sequences
The following sequences are available for this feature:
Legend: exonCDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGCTAGGCAAGAAAATGGTCTCCTTCAAGAAACTCGCCAAGAAAGTGAAGGTCCGAGTCGGAACAGAGGGCGAATCATCATCGCACAACGAGTGTTTGCTCAGAGATCGATTGGAATCATCGAAGGATCACGATTCTCACTCGCCGTCGCCGACTTCGACTCCGACCGGTTCTTTTGCTGTTTATGTCGGCGACGAACGGCAGCGCTTCGTCGTTCCGACGAGTTTCTTGTCGCATCCACTCTTTAGGATGCTGCTCGATAAAGCTTACAGAGAGTTCGGATTCGAACAGAGGAACGCGCTTGTGGTTCCTTGTAGCGTCTCTGCTTTTCAAGAAATTGTTAGCGCTGTGGAATGCTGCAATGGCAGATTCGATTTCGGCGAGATTGTCGAGGAGTTTCTTTAG ATGCTAGGCAAGAAAATGGTCTCCTTCAAGAAACTCGCCAAGAAAGTGAAGGTCCGAGTCGGAACAGAGGGCGAATCATCATCGCACAACGAGTGTTTGCTCAGAGATCGATTGGAATCATCGAAGGATCACGATTCTCACTCGCCGTCGCCGACTTCGACTCCGACCGGTTCTTTTGCTGTTTATGTCGGCGACGAACGGCAGCGCTTCGTCGTTCCGACGAGTTTCTTGTCGCATCCACTCTTTAGGATGCTGCTCGATAAAGCTTACAGAGAGTTCGGATTCGAACAGAGGAACGCGCTTGTGGTTCCTTGTAGCGTCTCTGCTTTTCAAGAAATTGTTAGCGCTGTGGAATGCTGCAATGGCAGATTCGATTTCGGCGAGATTGTCGAGGAGTTTCTTTAG ATGCTAGGCAAGAAAATGGTCTCCTTCAAGAAACTCGCCAAGAAAGTGAAGGTCCGAGTCGGAACAGAGGGCGAATCATCATCGCACAACGAGTGTTTGCTCAGAGATCGATTGGAATCATCGAAGGATCACGATTCTCACTCGCCGTCGCCGACTTCGACTCCGACCGGTTCTTTTGCTGTTTATGTCGGCGACGAACGGCAGCGCTTCGTCGTTCCGACGAGTTTCTTGTCGCATCCACTCTTTAGGATGCTGCTCGATAAAGCTTACAGAGAGTTCGGATTCGAACAGAGGAACGCGCTTGTGGTTCCTTGTAGCGTCTCTGCTTTTCAAGAAATTGTTAGCGCTGTGGAATGCTGCAATGGCAGATTCGATTTCGGCGAGATTGTCGAGGAGTTTCTTTAG MLGKKMVSFKKLAKKVKVRVGTEGESSSHNECLLRDRLESSKDHDSHSPSPTSTPTGSFAVYVGDERQRFVVPTSFLSHPLFRMLLDKAYREFGFEQRNALVVPCSVSAFQEIVSAVECCNGRFDFGEIVEEFL Homology
BLAST of Carg05359 vs. NCBI nr
Match: KAG7027194.1 (Auxin-responsive protein SAUR50, partial [Cucurbita argyrosperma subsp. argyrosperma]) HSP 1 Score: 268.5 bits (685), Expect = 3.2e-68 Identity = 134/134 (100.00%), Postives = 134/134 (100.00%), Query Frame = 0
BLAST of Carg05359 vs. NCBI nr
Match: XP_023517185.1 (auxin-responsive protein SAUR50-like [Cucurbita pepo subsp. pepo]) HSP 1 Score: 266.2 bits (679), Expect = 1.6e-67 Identity = 133/134 (99.25%), Postives = 133/134 (99.25%), Query Frame = 0
BLAST of Carg05359 vs. NCBI nr
Match: XP_022962864.1 (auxin-induced protein 6B-like [Cucurbita moschata]) HSP 1 Score: 263.5 bits (672), Expect = 1.0e-66 Identity = 134/136 (98.53%), Postives = 134/136 (98.53%), Query Frame = 0
BLAST of Carg05359 vs. NCBI nr
Match: KAG6595178.1 (Auxin-responsive protein SAUR50, partial [Cucurbita argyrosperma subsp. sororia]) HSP 1 Score: 262.7 bits (670), Expect = 1.7e-66 Identity = 134/138 (97.10%), Postives = 134/138 (97.10%), Query Frame = 0
BLAST of Carg05359 vs. NCBI nr
Match: XP_022972619.1 (auxin-responsive protein SAUR50-like [Cucurbita maxima]) HSP 1 Score: 258.1 bits (658), Expect = 4.3e-65 Identity = 132/134 (98.51%), Postives = 132/134 (98.51%), Query Frame = 0
BLAST of Carg05359 vs. ExPASy Swiss-Prot
Match: O65695 (Auxin-responsive protein SAUR50 OS=Arabidopsis thaliana OX=3702 GN=SAUR50 PE=1 SV=1) HSP 1 Score: 72.8 bits (177), Expect = 3.3e-12 Identity = 31/67 (46.27%), Postives = 41/67 (61.19%), Query Frame = 0
BLAST of Carg05359 vs. ExPASy Swiss-Prot
Match: Q9LTV3 (Auxin-responsive protein SAUR72 OS=Arabidopsis thaliana OX=3702 GN=SAUR72 PE=1 SV=1) HSP 1 Score: 68.6 bits (166), Expect = 6.3e-11 Identity = 29/66 (43.94%), Postives = 45/66 (68.18%), Query Frame = 0
BLAST of Carg05359 vs. ExPASy Swiss-Prot
Match: Q9ZUZ3 (Auxin-responsive protein SAUR32 OS=Arabidopsis thaliana OX=3702 GN=SAUR32 PE=2 SV=1) HSP 1 Score: 64.3 bits (155), Expect = 1.2e-09 Identity = 30/84 (35.71%), Postives = 49/84 (58.33%), Query Frame = 0
BLAST of Carg05359 vs. ExPASy Swiss-Prot
Match: O64538 (Auxin-responsive protein SAUR40 OS=Arabidopsis thaliana OX=3702 GN=SAUR40 PE=2 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 1.6e-09 Identity = 25/66 (37.88%), Postives = 47/66 (71.21%), Query Frame = 0
BLAST of Carg05359 vs. ExPASy Swiss-Prot
Match: Q9SA49 (Auxin-responsive protein SAUR41 OS=Arabidopsis thaliana OX=3702 GN=SAUR41 PE=2 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 1.6e-09 Identity = 29/84 (34.52%), Postives = 47/84 (55.95%), Query Frame = 0
BLAST of Carg05359 vs. ExPASy TrEMBL
Match: A0A6J1HIA1 (auxin-induced protein 6B-like OS=Cucurbita moschata OX=3662 GN=LOC111463231 PE=3 SV=1) HSP 1 Score: 263.5 bits (672), Expect = 4.9e-67 Identity = 134/136 (98.53%), Postives = 134/136 (98.53%), Query Frame = 0
BLAST of Carg05359 vs. ExPASy TrEMBL
Match: A0A6J1IC38 (auxin-responsive protein SAUR50-like OS=Cucurbita maxima OX=3661 GN=LOC111471159 PE=3 SV=1) HSP 1 Score: 258.1 bits (658), Expect = 2.1e-65 Identity = 132/134 (98.51%), Postives = 132/134 (98.51%), Query Frame = 0
BLAST of Carg05359 vs. ExPASy TrEMBL
Match: A0A6J1EDQ2 (auxin-induced protein 15A OS=Cucurbita moschata OX=3662 GN=LOC111433233 PE=3 SV=1) HSP 1 Score: 236.9 bits (603), Expect = 5.0e-59 Identity = 121/134 (90.30%), Postives = 128/134 (95.52%), Query Frame = 0
BLAST of Carg05359 vs. ExPASy TrEMBL
Match: A0A6J1ILC7 (auxin-induced protein 15A-like OS=Cucurbita maxima OX=3661 GN=LOC111478079 PE=3 SV=1) HSP 1 Score: 231.9 bits (590), Expect = 1.6e-57 Identity = 119/134 (88.81%), Postives = 127/134 (94.78%), Query Frame = 0
BLAST of Carg05359 vs. ExPASy TrEMBL
Match: A0A1S3CHA6 (auxin-induced protein X15 OS=Cucumis melo OX=3656 GN=LOC103500907 PE=3 SV=1) HSP 1 Score: 230.3 bits (586), Expect = 4.6e-57 Identity = 120/136 (88.24%), Postives = 127/136 (93.38%), Query Frame = 0
BLAST of Carg05359 vs. TAIR 10
Match: AT2G36210.1 (SAUR-like auxin-responsive protein family ) HSP 1 Score: 144.1 bits (362), Expect = 8.4e-35 Identity = 82/141 (58.16%), Postives = 103/141 (73.05%), Query Frame = 0
BLAST of Carg05359 vs. TAIR 10
Match: AT5G20810.1 (SAUR-like auxin-responsive protein family ) HSP 1 Score: 84.3 bits (207), Expect = 7.9e-17 Identity = 42/94 (44.68%), Postives = 60/94 (63.83%), Query Frame = 0
BLAST of Carg05359 vs. TAIR 10
Match: AT5G20810.2 (SAUR-like auxin-responsive protein family ) HSP 1 Score: 84.3 bits (207), Expect = 7.9e-17 Identity = 42/94 (44.68%), Postives = 60/94 (63.83%), Query Frame = 0
BLAST of Carg05359 vs. TAIR 10
Match: AT3G43120.1 (SAUR-like auxin-responsive protein family ) HSP 1 Score: 79.7 bits (195), Expect = 1.9e-15 Identity = 36/81 (44.44%), Postives = 53/81 (65.43%), Query Frame = 0
BLAST of Carg05359 vs. TAIR 10
Match: AT3G20210.2 (delta vacuolar processing enzyme ) HSP 1 Score: 74.7 bits (182), Expect = 6.3e-14 Identity = 41/118 (34.75%), Postives = 62/118 (52.54%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Silver-seed gourd (SMH-JMG-627) v2
Date Performed: 2021-10-25
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|