CSPI05G31320 (gene) Cucumber (PI 183967) v1

Overview


Name	CSPI05G31320
Type	gene
Organism	Cucumis sativus var. hardwickii cv. PI 183967 (Cucumber (PI 183967) v1)
Description	Unknown protein
Location	Chr5: 28868312 .. 28868584 (-)
RNA-Seq Expression	CSPI05G31320
Synteny	CSPI05G31320

Sequences

The following sequences are available for this feature:

Gene sequence (with intron)

Legend: CDSpolypeptide

Hold the cursor over a type above to highlight its positions in the sequence below.

ATGAGGTATGAAAATGTAAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGATGATAGATAGATATTGA

mRNA sequence

ATGAGGTATGAAAATGTAAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGATGATAGATAGATATTGA

Coding sequence (CDS)

ATGAGGTATGAAAATGTAAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGATGATAGATAGATATTGA

Protein sequence

MRYENVKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKMIDRY*

Homology

The following BLAST results are available for this feature:

BLAST of CSPI05G31320 vs.


Match Name	E-value	Identity	Description

BLAST of CSPI05G31320 vs.


Match Name	E-value	Identity	Description

BLAST of CSPI05G31320 vs.


Match Name	E-value	Identity	Description

BLAST of CSPI05G31320 vs.


Match Name	E-value	Identity	Description

InterPro

Analysis Name: InterPro Annotations of Cucumber (PI 183967) v1
Date Performed: 2021-10-25


IPR Term	IPR Description	Source	Source Term	Source Description	Alignment
None	No IPR available	COILS	Coil	Coil	coord: 3..89
None	No IPR available	MOBIDB_LITE	mobidb-lite	disorder_prediction	coord: 1..90
IPR005819	Linker histone H1/H5	PRINTS	PR00624	HISTONEH5	coord: 7..21 score: 37.78 coord: 37..54 score: 41.98 coord: 59..78 score: 39.44

Relationships

The following mRNA feature(s) are a part of this gene:


Feature Name	Unique Name	Type
CSPI05G31320.1	CSPI05G31320.1	mRNA

GO Annotation

GO Assignments

This gene is annotated with the following GO terms.

Category	Term Accession	Term Name
biological_process	GO:0006334	nucleosome assembly
cellular_component	GO:0000786	nucleosome
molecular_function	GO:0003677	DNA binding