CmoCh09G012040 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGACTAAAACTCAACCACAACTTATCGAACGTCGACTCGGATCTAATGTTTCAGTTTCAAGTCCCTTTCGAGGAGTACGGAAGCGGAGTTGGGGTCGCTATGTATCTGAGATACGGTTACCAGGGAAGAAGACACGAGTGTGGCTTGGCTCATTCGCCTCTCCAGAGATGGCCGCACGAGCCTACGACTCGGCAGCTGTATTTTTGAGAGGCACCTCTGCCTTGCTCAACTTTCCTGACTCTATCGGCTCGCTCCCACAACCAGAGTCATGCTCAAGAGAACATATTCAATCGGCAGCGGCAAAGGCAGCAGCGCAAATGAGAGAAATGGAGGTTGGAGAGCGAAAGGCGAGCAACGGATTGAGTCGAACCATGTTTGAGGAGATGAAGGAAGCACCATTGTTGAGTCCATTGAGGTTGGCTTGGCTTGGGTTTGGACCAGCCTCGGACGAAGAAGACAATTTGTTATTACCAGGCTATTTCTAA ATGACTAAAACTCAACCACAACTTATCGAACGTCGACTCGGATCTAATGTTTCAGTTTCAAGTCCCTTTCGAGGAGTACGGAAGCGGAGTTGGGGTCGCTATGTATCTGAGATACGGTTACCAGGGAAGAAGACACGAGTGTGGCTTGGCTCATTCGCCTCTCCAGAGATGGCCGCACGAGCCTACGACTCGGCAGCTGTATTTTTGAGAGGCACCTCTGCCTTGCTCAACTTTCCTGACTCTATCGGCTCGCTCCCACAACCAGAGTCATGCTCAAGAGAACATATTCAATCGGCAGCGGCAAAGGCAGCAGCGCAAATGAGAGAAATGGAGGTTGGAGAGCGAAAGGCGAGCAACGGATTGAGTCGAACCATGTTTGAGGAGATGAAGGAAGCACCATTGTTGAGTCCATTGAGGTTGGCTTGGCTTGGGTTTGGACCAGCCTCGGACGAAGAAGACAATTTGTTATTACCAGGCTATTTCTAA ATGACTAAAACTCAACCACAACTTATCGAACGTCGACTCGGATCTAATGTTTCAGTTTCAAGTCCCTTTCGAGGAGTACGGAAGCGGAGTTGGGGTCGCTATGTATCTGAGATACGGTTACCAGGGAAGAAGACACGAGTGTGGCTTGGCTCATTCGCCTCTCCAGAGATGGCCGCACGAGCCTACGACTCGGCAGCTGTATTTTTGAGAGGCACCTCTGCCTTGCTCAACTTTCCTGACTCTATCGGCTCGCTCCCACAACCAGAGTCATGCTCAAGAGAACATATTCAATCGGCAGCGGCAAAGGCAGCAGCGCAAATGAGAGAAATGGAGGTTGGAGAGCGAAAGGCGAGCAACGGATTGAGTCGAACCATGTTTGAGGAGATGAAGGAAGCACCATTGTTGAGTCCATTGAGGTTGGCTTGGCTTGGGTTTGGACCAGCCTCGGACGAAGAAGACAATTTGTTATTACCAGGCTATTTCTAA
BLAST of CmoCh09G012040 vs. Swiss-Prot
Match: ERF22_ARATH (Ethylene-responsive transcription factor ERF022 OS=Arabidopsis thaliana GN=ERF022 PE=2 SV=1) HSP 1 Score: 122.5 bits (306), Expect = 4.3e-27 Identity = 65/138 (47.10%), Postives = 90/138 (65.22%), Query Frame = 1
BLAST of CmoCh09G012040 vs. Swiss-Prot
Match: TINY_ARATH (Ethylene-responsive transcription factor TINY OS=Arabidopsis thaliana GN=TINY PE=2 SV=1) HSP 1 Score: 109.4 bits (272), Expect = 3.8e-23 Identity = 53/82 (64.63%), Postives = 66/82 (80.49%), Query Frame = 1
BLAST of CmoCh09G012040 vs. Swiss-Prot
Match: ERF23_ARATH (Ethylene-responsive transcription factor ERF023 OS=Arabidopsis thaliana GN=ERF023 PE=2 SV=1) HSP 1 Score: 106.3 bits (264), Expect = 3.2e-22 Identity = 52/92 (56.52%), Postives = 69/92 (75.00%), Query Frame = 1
BLAST of CmoCh09G012040 vs. Swiss-Prot
Match: ERF37_ARATH (Ethylene-responsive transcription factor ERF037 OS=Arabidopsis thaliana GN=ERF037 PE=2 SV=1) HSP 1 Score: 105.1 bits (261), Expect = 7.1e-22 Identity = 50/83 (60.24%), Postives = 69/83 (83.13%), Query Frame = 1
BLAST of CmoCh09G012040 vs. Swiss-Prot
Match: ERF36_ARATH (Ethylene-responsive transcription factor ERF036 OS=Arabidopsis thaliana GN=ERF036 PE=2 SV=2) HSP 1 Score: 104.4 bits (259), Expect = 1.2e-21 Identity = 57/110 (51.82%), Postives = 79/110 (71.82%), Query Frame = 1
BLAST of CmoCh09G012040 vs. TrEMBL
Match: A0A0A0KSQ8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G647260 PE=4 SV=1) HSP 1 Score: 228.8 bits (582), Expect = 4.7e-57 Identity = 123/167 (73.65%), Postives = 136/167 (81.44%), Query Frame = 1
BLAST of CmoCh09G012040 vs. TrEMBL
Match: U5FIC5_POPTR (Uncharacterized protein (Fragment) OS=Populus trichocarpa GN=POPTR_0019s09530g PE=4 SV=1) HSP 1 Score: 152.9 bits (385), Expect = 3.3e-34 Identity = 85/136 (62.50%), Postives = 95/136 (69.85%), Query Frame = 1
BLAST of CmoCh09G012040 vs. TrEMBL
Match: A9PL84_POPTR (TINY-like protein OS=Populus trichocarpa GN=TINYL15 PE=4 SV=1) HSP 1 Score: 152.9 bits (385), Expect = 3.3e-34 Identity = 85/136 (62.50%), Postives = 95/136 (69.85%), Query Frame = 1
BLAST of CmoCh09G012040 vs. TrEMBL
Match: A9PL85_POPTR (TINY-like protein OS=Populus trichocarpa GN=TINYL16 PE=4 SV=1) HSP 1 Score: 152.9 bits (385), Expect = 3.3e-34 Identity = 85/136 (62.50%), Postives = 95/136 (69.85%), Query Frame = 1
BLAST of CmoCh09G012040 vs. TrEMBL
Match: K7LFN0_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_09G233800 PE=4 SV=1) HSP 1 Score: 152.1 bits (383), Expect = 5.6e-34 Identity = 90/170 (52.94%), Postives = 111/170 (65.29%), Query Frame = 1
BLAST of CmoCh09G012040 vs. TAIR10
Match: AT1G33760.1 (AT1G33760.1 Integrase-type DNA-binding superfamily protein) HSP 1 Score: 122.5 bits (306), Expect = 2.4e-28 Identity = 65/138 (47.10%), Postives = 90/138 (65.22%), Query Frame = 1
BLAST of CmoCh09G012040 vs. TAIR10
Match: AT5G25810.1 (AT5G25810.1 Integrase-type DNA-binding superfamily protein) HSP 1 Score: 109.4 bits (272), Expect = 2.1e-24 Identity = 53/82 (64.63%), Postives = 66/82 (80.49%), Query Frame = 1
BLAST of CmoCh09G012040 vs. TAIR10
Match: AT1G01250.1 (AT1G01250.1 Integrase-type DNA-binding superfamily protein) HSP 1 Score: 106.3 bits (264), Expect = 1.8e-23 Identity = 52/92 (56.52%), Postives = 69/92 (75.00%), Query Frame = 1
BLAST of CmoCh09G012040 vs. TAIR10
Match: AT1G77200.1 (AT1G77200.1 Integrase-type DNA-binding superfamily protein) HSP 1 Score: 105.1 bits (261), Expect = 4.0e-23 Identity = 50/83 (60.24%), Postives = 69/83 (83.13%), Query Frame = 1
BLAST of CmoCh09G012040 vs. TAIR10
Match: AT3G16280.1 (AT3G16280.1 Integrase-type DNA-binding superfamily protein) HSP 1 Score: 104.4 bits (259), Expect = 6.8e-23 Identity = 57/110 (51.82%), Postives = 79/110 (71.82%), Query Frame = 1
BLAST of CmoCh09G012040 vs. NCBI nr
Match: gi|449447711|ref|XP_004141611.1| (PREDICTED: ethylene-responsive transcription factor ERF022-like [Cucumis sativus]) HSP 1 Score: 228.8 bits (582), Expect = 6.8e-57 Identity = 123/167 (73.65%), Postives = 136/167 (81.44%), Query Frame = 1
BLAST of CmoCh09G012040 vs. NCBI nr
Match: gi|659119539|ref|XP_008459710.1| (PREDICTED: ethylene-responsive transcription factor ERF022-like [Cucumis melo]) HSP 1 Score: 221.9 bits (564), Expect = 8.3e-55 Identity = 119/165 (72.12%), Postives = 134/165 (81.21%), Query Frame = 1
BLAST of CmoCh09G012040 vs. NCBI nr
Match: gi|1009178830|ref|XP_015870745.1| (PREDICTED: ethylene-responsive transcription factor ERF039-like [Ziziphus jujuba]) HSP 1 Score: 156.8 bits (395), Expect = 3.3e-35 Identity = 90/165 (54.55%), Postives = 106/165 (64.24%), Query Frame = 1
BLAST of CmoCh09G012040 vs. NCBI nr
Match: gi|566256005|ref|XP_006388007.1| (hypothetical protein POPTR_0409s00200g [Populus trichocarpa]) HSP 1 Score: 152.9 bits (385), Expect = 4.7e-34 Identity = 85/136 (62.50%), Postives = 95/136 (69.85%), Query Frame = 1
BLAST of CmoCh09G012040 vs. NCBI nr
Match: gi|566238626|ref|XP_006371370.1| (hypothetical protein POPTR_0019s09530g, partial [Populus trichocarpa]) HSP 1 Score: 152.9 bits (385), Expect = 4.7e-34 Identity = 85/136 (62.50%), Postives = 95/136 (69.85%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|