Csa6G493910 (gene) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
Legend: CDSthree_prime_UTR Hold the cursor over a type above to highlight its positions in the sequence below.ATGGAGAAGCGGGAGGCCGATCAGTCGCAGGGACAAAACAAGGAGATCAGGAAAAGCGAAAGGGAAAAGGAGAGATCAGAGGAAATTCCGTTGGAGAGCAGTCCGTACGTGAATTATGAAGACTTGGAAGATTACAAAAATCAAGCCTACGGAACACAAGGCCATCTTCAGCCCAAGCCCGGCCGTGGCGGAGGCGGTGGCCCAACCGACGCCCCCACTCTCTCCGGCGACGCCGCCGCGACACGTCGGTGATTAACCGCCAAGGAGTACCCTGAGAAGACATTCGCTGGCGCTTTCTTTGGCCGTTCTGTTTTATTAAGGAATATTTGTTTTGCTGTAGGCTGAGTCTTGTTAATGTGTAACCTTACAATGGGTAAGGTAATGAATGAAAACAGTTGGAATAATCGGAATGGTATTATTAAAAAATTGATGACACTTACTAAATAATGAAGAGCAATATGTCGGTGT ATGGAGAAGCGGGAGGCCGATCAGTCGCAGGGACAAAACAAGGAGATCAGGAAAAGCGAAAGGGAAAAGGAGAGATCAGAGGAAATTCCGTTGGAGAGCAGTCCGTACGTGAATTATGAAGACTTGGAAGATTACAAAAATCAAGCCTACGGAACACAAGGCCATCTTCAGCCCAAGCCCGGCCGTGGCGGAGGCGGTGGCCCAACCGACGCCCCCACTCTCTCCGGCGACGCCGCCGCGACACGTCGGTGA ATGGAGAAGCGGGAGGCCGATCAGTCGCAGGGACAAAACAAGGAGATCAGGAAAAGCGAAAGGGAAAAGGAGAGATCAGAGGAAATTCCGTTGGAGAGCAGTCCGTACGTGAATTATGAAGACTTGGAAGATTACAAAAATCAAGCCTACGGAACACAAGGCCATCTTCAGCCCAAGCCCGGCCGTGGCGGAGGCGGTGGCCCAACCGACGCCCCCACTCTCTCCGGCGACGCCGCCGCGACACGTCGGTGA MEKREADQSQGQNKEIRKSEREKERSEEIPLESSPYVNYEDLEDYKNQAYGTQGHLQPKPGRGGGGGPTDAPTLSGDAAATRR*
BLAST of Csa6G493910 vs. TrEMBL
Match: A0A0A0KGG1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G493910 PE=4 SV=1) HSP 1 Score: 172.9 bits (437), Expect = 1.6e-40 Identity = 83/83 (100.00%), Postives = 83/83 (100.00%), Query Frame = 1
BLAST of Csa6G493910 vs. TrEMBL
Match: V4SFD8_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10026786mg PE=4 SV=1) HSP 1 Score: 97.1 bits (240), Expect = 1.1e-17 Identity = 44/81 (54.32%), Postives = 60/81 (74.07%), Query Frame = 1
BLAST of Csa6G493910 vs. TrEMBL
Match: A0A0J8CCV2_BETVU (Uncharacterized protein OS=Beta vulgaris subsp. vulgaris GN=BVRB_6g127730 PE=4 SV=1) HSP 1 Score: 89.7 bits (221), Expect = 1.8e-15 Identity = 46/79 (58.23%), Postives = 58/79 (73.42%), Query Frame = 1
BLAST of Csa6G493910 vs. TrEMBL
Match: A0A067K721_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_12502 PE=4 SV=1) HSP 1 Score: 87.8 bits (216), Expect = 6.8e-15 Identity = 41/65 (63.08%), Postives = 50/65 (76.92%), Query Frame = 1
BLAST of Csa6G493910 vs. TrEMBL
Match: F6I6V2_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_18s0122g00820 PE=4 SV=1) HSP 1 Score: 87.4 bits (215), Expect = 8.9e-15 Identity = 41/70 (58.57%), Postives = 53/70 (75.71%), Query Frame = 1
BLAST of Csa6G493910 vs. TAIR10
Match: AT2G33690.1 (AT2G33690.1 Late embryogenesis abundant protein, group 6) HSP 1 Score: 79.7 bits (195), Expect = 9.4e-16 Identity = 37/58 (63.79%), Postives = 40/58 (68.97%), Query Frame = 1
BLAST of Csa6G493910 vs. TAIR10
Match: AT2G23120.1 (AT2G23120.1 Late embryogenesis abundant protein, group 6) HSP 1 Score: 61.6 bits (148), Expect = 2.6e-10 Identity = 33/76 (43.42%), Postives = 44/76 (57.89%), Query Frame = 1
BLAST of Csa6G493910 vs. TAIR10
Match: AT2G23110.1 (AT2G23110.1 Late embryogenesis abundant protein, group 6) HSP 1 Score: 60.1 bits (144), Expect = 7.7e-10 Identity = 27/59 (45.76%), Postives = 40/59 (67.80%), Query Frame = 1
BLAST of Csa6G493910 vs. NCBI nr
Match: gi|778718556|ref|XP_011657884.1| (PREDICTED: uncharacterized protein LOC105435909 [Cucumis sativus]) HSP 1 Score: 172.9 bits (437), Expect = 2.3e-40 Identity = 83/83 (100.00%), Postives = 83/83 (100.00%), Query Frame = 1
BLAST of Csa6G493910 vs. NCBI nr
Match: gi|567866839|ref|XP_006426042.1| (hypothetical protein CICLE_v10026786mg [Citrus clementina]) HSP 1 Score: 97.1 bits (240), Expect = 1.6e-17 Identity = 44/81 (54.32%), Postives = 60/81 (74.07%), Query Frame = 1
BLAST of Csa6G493910 vs. NCBI nr
Match: gi|568824226|ref|XP_006466503.1| (PREDICTED: uncharacterized protein LOC102616141 [Citrus sinensis]) HSP 1 Score: 96.3 bits (238), Expect = 2.7e-17 Identity = 44/81 (54.32%), Postives = 60/81 (74.07%), Query Frame = 1
BLAST of Csa6G493910 vs. NCBI nr
Match: gi|720068635|ref|XP_010277173.1| (PREDICTED: uncharacterized protein LOC104611696 [Nelumbo nucifera]) HSP 1 Score: 90.9 bits (224), Expect = 1.2e-15 Identity = 45/81 (55.56%), Postives = 59/81 (72.84%), Query Frame = 1
BLAST of Csa6G493910 vs. NCBI nr
Match: gi|731337043|ref|XP_010679579.1| (PREDICTED: uncharacterized protein LOC104894915 [Beta vulgaris subsp. vulgaris]) HSP 1 Score: 89.7 bits (221), Expect = 2.6e-15 Identity = 46/79 (58.23%), Postives = 58/79 (73.42%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
This gene is associated with the following unigenes:
The following mRNA feature(s) are a part of this gene:
The following transcribed_cluster feature(s) are associated with this gene:
Analysis Name: InterPro Annotations of cucumber (Chinese Long)
Date Performed: 2016-09-28
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |