ClCG01G017300 (gene) Watermelon (Charleston Gray)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGATAAGCGCGAGGCCGATCAGCCGCAGCGGCAACAAGAGGAGAGGAAAAGCGAAAGGGAAAAGGAGAGATCAGAAGGCATTCCGTTGCAGAGCAGTCCGTACGTGAATTATAAAGACTTGGAAGATTACAAAAACCAAGCCTACGGAACTCAAGGCCATCTTCAGCCCAAGCCCGGCCGTGGCGGCGGCGGTGGTCCCACCGACGCCCCCACTCTCTCCGGTGACGCCGTCGCTTCCTCGGTGATTAACCGCCAAGGAGTACCCTGA ATGGATAAGCGCGAGGCCGATCAGCCGCAGCGGCAACAAGAGGAGAGGAAAAGCGAAAGGGAAAAGGAGAGATCAGAAGGCATTCCGTTGCAGAGCAGTCCGTACGTGAATTATAAAGACTTGGAAGATTACAAAAACCAAGCCTACGGAACTCAAGGCCATCTTCAGCCCAAGCCCGGCCGTGGCGGCGGCGGTGGTCCCACCGACGCCCCCACTCTCTCCGGTGACGCCGTCGCTTCCTCGGTGATTAACCGCCAAGGAGTACCCTGA ATGGATAAGCGCGAGGCCGATCAGCCGCAGCGGCAACAAGAGGAGAGGAAAAGCGAAAGGGAAAAGGAGAGATCAGAAGGCATTCCGTTGCAGAGCAGTCCGTACGTGAATTATAAAGACTTGGAAGATTACAAAAACCAAGCCTACGGAACTCAAGGCCATCTTCAGCCCAAGCCCGGCCGTGGCGGCGGCGGTGGTCCCACCGACGCCCCCACTCTCTCCGGTGACGCCGTCGCTTCCTCGGTGATTAACCGCCAAGGAGTACCCTGA MDKREADQPQRQQEERKSEREKERSEGIPLQSSPYVNYKDLEDYKNQAYGTQGHLQPKPGRGGGGGPTDAPTLSGDAVASSVINRQGVP
BLAST of ClCG01G017300 vs. TrEMBL
Match: A0A0A0KGG1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G493910 PE=4 SV=1) HSP 1 Score: 144.4 bits (363), Expect = 6.5e-32 Identity = 70/81 (86.42%), Postives = 75/81 (92.59%), Query Frame = 1
BLAST of ClCG01G017300 vs. TrEMBL
Match: V4SFD8_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10026786mg PE=4 SV=1) HSP 1 Score: 108.2 bits (269), Expect = 5.1e-21 Identity = 54/95 (56.84%), Postives = 67/95 (70.53%), Query Frame = 1
BLAST of ClCG01G017300 vs. TrEMBL
Match: A0A0J8CCV2_BETVU (Uncharacterized protein OS=Beta vulgaris subsp. vulgaris GN=BVRB_6g127730 PE=4 SV=1) HSP 1 Score: 105.1 bits (261), Expect = 4.4e-20 Identity = 50/83 (60.24%), Postives = 62/83 (74.70%), Query Frame = 1
BLAST of ClCG01G017300 vs. TrEMBL
Match: A0A0B2SB75_GLYSO (Uncharacterized protein OS=Glycine soja GN=glysoja_040949 PE=4 SV=1) HSP 1 Score: 96.3 bits (238), Expect = 2.0e-17 Identity = 50/97 (51.55%), Postives = 64/97 (65.98%), Query Frame = 1
BLAST of ClCG01G017300 vs. TrEMBL
Match: Q9S7N8_SOYBN (Seed maturation protein PM21 OS=Glycine max GN=PM21 PE=2 SV=1) HSP 1 Score: 96.3 bits (238), Expect = 2.0e-17 Identity = 50/97 (51.55%), Postives = 64/97 (65.98%), Query Frame = 1
BLAST of ClCG01G017300 vs. TAIR10
Match: AT2G33690.1 (AT2G33690.1 Late embryogenesis abundant protein, group 6) HSP 1 Score: 75.5 bits (184), Expect = 1.9e-14 Identity = 34/62 (54.84%), Postives = 41/62 (66.13%), Query Frame = 1
BLAST of ClCG01G017300 vs. TAIR10
Match: AT2G23110.1 (AT2G23110.1 Late embryogenesis abundant protein, group 6) HSP 1 Score: 67.4 bits (163), Expect = 5.1e-12 Identity = 36/93 (38.71%), Postives = 52/93 (55.91%), Query Frame = 1
BLAST of ClCG01G017300 vs. TAIR10
Match: AT2G23120.1 (AT2G23120.1 Late embryogenesis abundant protein, group 6) HSP 1 Score: 61.2 bits (147), Expect = 3.6e-10 Identity = 34/67 (50.75%), Postives = 43/67 (64.18%), Query Frame = 1
BLAST of ClCG01G017300 vs. NCBI nr
Match: gi|778718556|ref|XP_011657884.1| (PREDICTED: uncharacterized protein LOC105435909 [Cucumis sativus]) HSP 1 Score: 144.4 bits (363), Expect = 9.3e-32 Identity = 70/81 (86.42%), Postives = 75/81 (92.59%), Query Frame = 1
BLAST of ClCG01G017300 vs. NCBI nr
Match: gi|567866839|ref|XP_006426042.1| (hypothetical protein CICLE_v10026786mg [Citrus clementina]) HSP 1 Score: 108.2 bits (269), Expect = 7.4e-21 Identity = 54/95 (56.84%), Postives = 67/95 (70.53%), Query Frame = 1
BLAST of ClCG01G017300 vs. NCBI nr
Match: gi|568824226|ref|XP_006466503.1| (PREDICTED: uncharacterized protein LOC102616141 [Citrus sinensis]) HSP 1 Score: 107.5 bits (267), Expect = 1.3e-20 Identity = 54/95 (56.84%), Postives = 66/95 (69.47%), Query Frame = 1
BLAST of ClCG01G017300 vs. NCBI nr
Match: gi|731337043|ref|XP_010679579.1| (PREDICTED: uncharacterized protein LOC104894915 [Beta vulgaris subsp. vulgaris]) HSP 1 Score: 105.1 bits (261), Expect = 6.2e-20 Identity = 50/83 (60.24%), Postives = 62/83 (74.70%), Query Frame = 1
BLAST of ClCG01G017300 vs. NCBI nr
Match: gi|1009166522|ref|XP_015901635.1| (PREDICTED: uncharacterized protein LOC107434664 [Ziziphus jujuba]) HSP 1 Score: 98.6 bits (244), Expect = 5.8e-18 Identity = 49/90 (54.44%), Postives = 59/90 (65.56%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of watermelon (Charleston Gray)
Date Performed: 2016-09-28
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |