CmoCh20G007960 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: polypeptideCDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGGGGATTCGATTGCTATCCTTGGTTCCTCATGCCAAGCAAATCCTAAAGATGCAGTCAGGTATCACTAAAAGTCAGTTGGATGTTCCAAAAGGTCATGTAGCCGTGTATGTGGGAGAGATCCAAAGGAAGAGATTCGTGGTTCCAATATCATACTTGAACCACCCATCATTCCAGCAACTGCTCAGCCGTGCAGAGGAAGAGTTTGGCTTCCATCATCCGCAGGGCGCTCTAACTATTCCTTGCAAAGAGGATGCCTTTATTAATCTTACTTCAAGATTGCAAGTCTCTTGA ATGGGGATTCGATTGCTATCCTTGGTTCCTCATGCCAAGCAAATCCTAAAGATGCAGTCAGGTATCACTAAAAGTCAGTTGGATGTTCCAAAAGGTCATGTAGCCGTGTATGTGGGAGAGATCCAAAGGAAGAGATTCGTGGTTCCAATATCATACTTGAACCACCCATCATTCCAGCAACTGCTCAGCCGTGCAGAGGAAGAGTTTGGCTTCCATCATCCGCAGGGCGCTCTAACTATTCCTTGCAAAGAGGATGCCTTTATTAATCTTACTTCAAGATTGCAAGTCTCTTGA ATGGGGATTCGATTGCTATCCTTGGTTCCTCATGCCAAGCAAATCCTAAAGATGCAGTCAGGTATCACTAAAAGTCAGTTGGATGTTCCAAAAGGTCATGTAGCCGTGTATGTGGGAGAGATCCAAAGGAAGAGATTCGTGGTTCCAATATCATACTTGAACCACCCATCATTCCAGCAACTGCTCAGCCGTGCAGAGGAAGAGTTTGGCTTCCATCATCCGCAGGGCGCTCTAACTATTCCTTGCAAAGAGGATGCCTTTATTAATCTTACTTCAAGATTGCAAGTCTCTTGA
BLAST of CmoCh20G007960 vs. Swiss-Prot
Match: SAU24_ARATH (Auxin-responsive protein SAUR24 OS=Arabidopsis thaliana GN=SAUR24 PE=2 SV=1) HSP 1 Score: 113.2 bits (282), Expect = 1.6e-24 Identity = 54/84 (64.29%), Postives = 65/84 (77.38%), Query Frame = 1
BLAST of CmoCh20G007960 vs. Swiss-Prot
Match: SAU20_ARATH (Auxin-responsive protein SAUR20 OS=Arabidopsis thaliana GN=SAUR20 PE=2 SV=1) HSP 1 Score: 110.9 bits (276), Expect = 7.8e-24 Identity = 52/79 (65.82%), Postives = 61/79 (77.22%), Query Frame = 1
BLAST of CmoCh20G007960 vs. Swiss-Prot
Match: SAU22_ARATH (Auxin-responsive protein SAUR22 OS=Arabidopsis thaliana GN=SAUR22 PE=2 SV=1) HSP 1 Score: 110.2 bits (274), Expect = 1.3e-23 Identity = 52/84 (61.90%), Postives = 64/84 (76.19%), Query Frame = 1
BLAST of CmoCh20G007960 vs. Swiss-Prot
Match: SAU19_ARATH (Auxin-responsive protein SAUR19 OS=Arabidopsis thaliana GN=SAUR19 PE=2 SV=1) HSP 1 Score: 109.0 bits (271), Expect = 3.0e-23 Identity = 51/79 (64.56%), Postives = 62/79 (78.48%), Query Frame = 1
BLAST of CmoCh20G007960 vs. Swiss-Prot
Match: SAU23_ARATH (Auxin-responsive protein SAUR23 OS=Arabidopsis thaliana GN=SAUR23 PE=2 SV=1) HSP 1 Score: 109.0 bits (271), Expect = 3.0e-23 Identity = 52/83 (62.65%), Postives = 63/83 (75.90%), Query Frame = 1
BLAST of CmoCh20G007960 vs. TrEMBL
Match: A0A0A0LIZ9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G258760 PE=4 SV=1) HSP 1 Score: 179.1 bits (453), Expect = 2.6e-42 Identity = 85/97 (87.63%), Postives = 92/97 (94.85%), Query Frame = 1
BLAST of CmoCh20G007960 vs. TrEMBL
Match: A0A0A0LLF1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G258700 PE=4 SV=1) HSP 1 Score: 178.7 bits (452), Expect = 3.4e-42 Identity = 85/97 (87.63%), Postives = 91/97 (93.81%), Query Frame = 1
BLAST of CmoCh20G007960 vs. TrEMBL
Match: A0A0A0LPI0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G258720 PE=4 SV=1) HSP 1 Score: 178.3 bits (451), Expect = 4.4e-42 Identity = 86/97 (88.66%), Postives = 91/97 (93.81%), Query Frame = 1
BLAST of CmoCh20G007960 vs. TrEMBL
Match: A0A0A0LJ99_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G258740 PE=4 SV=1) HSP 1 Score: 172.9 bits (437), Expect = 1.9e-40 Identity = 82/97 (84.54%), Postives = 90/97 (92.78%), Query Frame = 1
BLAST of CmoCh20G007960 vs. TrEMBL
Match: A0A0A0LJA3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G258790 PE=4 SV=1) HSP 1 Score: 171.4 bits (433), Expect = 5.4e-40 Identity = 84/97 (86.60%), Postives = 88/97 (90.72%), Query Frame = 1
BLAST of CmoCh20G007960 vs. TAIR10
Match: AT4G38840.1 (AT4G38840.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 115.2 bits (287), Expect = 2.3e-26 Identity = 57/97 (58.76%), Postives = 71/97 (73.20%), Query Frame = 1
BLAST of CmoCh20G007960 vs. TAIR10
Match: AT4G34810.1 (AT4G34810.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 114.0 bits (284), Expect = 5.2e-26 Identity = 59/105 (56.19%), Postives = 77/105 (73.33%), Query Frame = 1
BLAST of CmoCh20G007960 vs. TAIR10
Match: AT2G21210.1 (AT2G21210.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 113.2 bits (282), Expect = 8.8e-26 Identity = 55/98 (56.12%), Postives = 74/98 (75.51%), Query Frame = 1
BLAST of CmoCh20G007960 vs. TAIR10
Match: AT5G18080.1 (AT5G18080.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 113.2 bits (282), Expect = 8.8e-26 Identity = 54/84 (64.29%), Postives = 65/84 (77.38%), Query Frame = 1
BLAST of CmoCh20G007960 vs. TAIR10
Match: AT5G18020.1 (AT5G18020.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 110.9 bits (276), Expect = 4.4e-25 Identity = 52/79 (65.82%), Postives = 61/79 (77.22%), Query Frame = 1
BLAST of CmoCh20G007960 vs. NCBI nr
Match: gi|659115596|ref|XP_008457635.1| (PREDICTED: auxin-induced protein 15A-like [Cucumis melo]) HSP 1 Score: 182.6 bits (462), Expect = 3.4e-43 Identity = 88/97 (90.72%), Postives = 92/97 (94.85%), Query Frame = 1
BLAST of CmoCh20G007960 vs. NCBI nr
Match: gi|700206761|gb|KGN61880.1| (hypothetical protein Csa_2G258760 [Cucumis sativus]) HSP 1 Score: 179.1 bits (453), Expect = 3.7e-42 Identity = 85/97 (87.63%), Postives = 92/97 (94.85%), Query Frame = 1
BLAST of CmoCh20G007960 vs. NCBI nr
Match: gi|659115592|ref|XP_008457632.1| (PREDICTED: auxin-induced protein 15A-like [Cucumis melo]) HSP 1 Score: 179.1 bits (453), Expect = 3.7e-42 Identity = 86/97 (88.66%), Postives = 93/97 (95.88%), Query Frame = 1
BLAST of CmoCh20G007960 vs. NCBI nr
Match: gi|778674175|ref|XP_011650154.1| (PREDICTED: auxin-induced protein 15A-like [Cucumis sativus]) HSP 1 Score: 178.7 bits (452), Expect = 4.8e-42 Identity = 85/97 (87.63%), Postives = 91/97 (93.81%), Query Frame = 1
BLAST of CmoCh20G007960 vs. NCBI nr
Match: gi|700206757|gb|KGN61876.1| (hypothetical protein Csa_2G258720 [Cucumis sativus]) HSP 1 Score: 178.3 bits (451), Expect = 6.3e-42 Identity = 86/97 (88.66%), Postives = 91/97 (93.81%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene:
|