CSPI02G12970 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: five_prime_UTRCDS Hold the cursor over a type above to highlight its positions in the sequence below.TCCTCTTCTACTTGCTTCTGTACCAATCTGAACAAAACTTCAAATCTTTCTTAGTCTTTCATCATAACACAAATGGGGGTTCCATTACTATGTTTGGTTCCTCATGCAAAGAAAATCTTGAAGATGCAGTCAAGTTTTACCAAAAACCAACTGGATGTTCCAAAAGGCCATGTGGCGGTTTACGTGGGAGAGATTCAAAGGAAACGGTTCGTGGTTCCGGTATCTTACTTAAACGATCCATCGTTCCAACAACTGCTCAGCCGTGCAGAGGAAGAGTTTGGCTTCCACCATCCCCATGGGGGTCTAACAATTCCTTGCAAAGAAGATGCCTTTGTTGATCTCACTTCTAGATTAAAAGTAGCTTGA ATGGGGGTTCCATTACTATGTTTGGTTCCTCATGCAAAGAAAATCTTGAAGATGCAGTCAAGTTTTACCAAAAACCAACTGGATGTTCCAAAAGGCCATGTGGCGGTTTACGTGGGAGAGATTCAAAGGAAACGGTTCGTGGTTCCGGTATCTTACTTAAACGATCCATCGTTCCAACAACTGCTCAGCCGTGCAGAGGAAGAGTTTGGCTTCCACCATCCCCATGGGGGTCTAACAATTCCTTGCAAAGAAGATGCCTTTGTTGATCTCACTTCTAGATTAAAAGTAGCTTGA ATGGGGGTTCCATTACTATGTTTGGTTCCTCATGCAAAGAAAATCTTGAAGATGCAGTCAAGTTTTACCAAAAACCAACTGGATGTTCCAAAAGGCCATGTGGCGGTTTACGTGGGAGAGATTCAAAGGAAACGGTTCGTGGTTCCGGTATCTTACTTAAACGATCCATCGTTCCAACAACTGCTCAGCCGTGCAGAGGAAGAGTTTGGCTTCCACCATCCCCATGGGGGTCTAACAATTCCTTGCAAAGAAGATGCCTTTGTTGATCTCACTTCTAGATTAAAAGTAGCTTGA
BLAST of CSPI02G12970 vs. Swiss-Prot
Match: SAU24_ARATH (Auxin-responsive protein SAUR24 OS=Arabidopsis thaliana GN=SAUR24 PE=2 SV=1) HSP 1 Score: 112.5 bits (280), Expect = 2.7e-24 Identity = 55/84 (65.48%), Postives = 65/84 (77.38%), Query Frame = 1
BLAST of CSPI02G12970 vs. Swiss-Prot
Match: SAU20_ARATH (Auxin-responsive protein SAUR20 OS=Arabidopsis thaliana GN=SAUR20 PE=2 SV=1) HSP 1 Score: 111.3 bits (277), Expect = 6.0e-24 Identity = 53/84 (63.10%), Postives = 64/84 (76.19%), Query Frame = 1
BLAST of CSPI02G12970 vs. Swiss-Prot
Match: SAU23_ARATH (Auxin-responsive protein SAUR23 OS=Arabidopsis thaliana GN=SAUR23 PE=2 SV=1) HSP 1 Score: 110.5 bits (275), Expect = 1.0e-23 Identity = 52/83 (62.65%), Postives = 64/83 (77.11%), Query Frame = 1
BLAST of CSPI02G12970 vs. Swiss-Prot
Match: SAU22_ARATH (Auxin-responsive protein SAUR22 OS=Arabidopsis thaliana GN=SAUR22 PE=2 SV=1) HSP 1 Score: 110.2 bits (274), Expect = 1.3e-23 Identity = 51/84 (60.71%), Postives = 65/84 (77.38%), Query Frame = 1
BLAST of CSPI02G12970 vs. Swiss-Prot
Match: SAU19_ARATH (Auxin-responsive protein SAUR19 OS=Arabidopsis thaliana GN=SAUR19 PE=2 SV=1) HSP 1 Score: 109.4 bits (272), Expect = 2.3e-23 Identity = 53/84 (63.10%), Postives = 65/84 (77.38%), Query Frame = 1
BLAST of CSPI02G12970 vs. TrEMBL
Match: A0A0A0LJ99_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G258740 PE=4 SV=1) HSP 1 Score: 204.1 bits (518), Expect = 7.6e-50 Identity = 97/97 (100.00%), Postives = 97/97 (100.00%), Query Frame = 1
BLAST of CSPI02G12970 vs. TrEMBL
Match: A0A0A0LPI0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G258720 PE=4 SV=1) HSP 1 Score: 186.0 bits (471), Expect = 2.1e-44 Identity = 88/97 (90.72%), Postives = 92/97 (94.85%), Query Frame = 1
BLAST of CSPI02G12970 vs. TrEMBL
Match: A0A0A0LLF1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G258700 PE=4 SV=1) HSP 1 Score: 168.7 bits (426), Expect = 3.5e-39 Identity = 77/97 (79.38%), Postives = 87/97 (89.69%), Query Frame = 1
BLAST of CSPI02G12970 vs. TrEMBL
Match: A0A0A0LJA3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G258790 PE=4 SV=1) HSP 1 Score: 166.8 bits (421), Expect = 1.3e-38 Identity = 79/97 (81.44%), Postives = 85/97 (87.63%), Query Frame = 1
BLAST of CSPI02G12970 vs. TrEMBL
Match: A0A0A0LIZ9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G258760 PE=4 SV=1) HSP 1 Score: 166.8 bits (421), Expect = 1.3e-38 Identity = 75/97 (77.32%), Postives = 87/97 (89.69%), Query Frame = 1
BLAST of CSPI02G12970 vs. TAIR10
Match: AT4G38840.1 (AT4G38840.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 116.3 bits (290), Expect = 1.1e-26 Identity = 56/97 (57.73%), Postives = 72/97 (74.23%), Query Frame = 1
BLAST of CSPI02G12970 vs. TAIR10
Match: AT4G34810.1 (AT4G34810.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 114.0 bits (284), Expect = 5.2e-26 Identity = 58/105 (55.24%), Postives = 76/105 (72.38%), Query Frame = 1
BLAST of CSPI02G12970 vs. TAIR10
Match: AT5G18080.1 (AT5G18080.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 112.5 bits (280), Expect = 1.5e-25 Identity = 55/84 (65.48%), Postives = 65/84 (77.38%), Query Frame = 1
BLAST of CSPI02G12970 vs. TAIR10
Match: AT2G21210.1 (AT2G21210.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 112.1 bits (279), Expect = 2.0e-25 Identity = 53/98 (54.08%), Postives = 73/98 (74.49%), Query Frame = 1
BLAST of CSPI02G12970 vs. TAIR10
Match: AT5G18020.1 (AT5G18020.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 111.3 bits (277), Expect = 3.4e-25 Identity = 53/84 (63.10%), Postives = 64/84 (76.19%), Query Frame = 1
BLAST of CSPI02G12970 vs. NCBI nr
Match: gi|778669593|ref|XP_011649273.1| (PREDICTED: auxin-induced protein 15A-like [Cucumis sativus]) HSP 1 Score: 204.1 bits (518), Expect = 1.1e-49 Identity = 97/97 (100.00%), Postives = 97/97 (100.00%), Query Frame = 1
BLAST of CSPI02G12970 vs. NCBI nr
Match: gi|659115592|ref|XP_008457632.1| (PREDICTED: auxin-induced protein 15A-like [Cucumis melo]) HSP 1 Score: 186.8 bits (473), Expect = 1.8e-44 Identity = 87/97 (89.69%), Postives = 94/97 (96.91%), Query Frame = 1
BLAST of CSPI02G12970 vs. NCBI nr
Match: gi|700206757|gb|KGN61876.1| (hypothetical protein Csa_2G258720 [Cucumis sativus]) HSP 1 Score: 186.0 bits (471), Expect = 3.1e-44 Identity = 88/97 (90.72%), Postives = 92/97 (94.85%), Query Frame = 1
BLAST of CSPI02G12970 vs. NCBI nr
Match: gi|659115596|ref|XP_008457635.1| (PREDICTED: auxin-induced protein 15A-like [Cucumis melo]) HSP 1 Score: 176.0 bits (445), Expect = 3.2e-41 Identity = 82/97 (84.54%), Postives = 89/97 (91.75%), Query Frame = 1
BLAST of CSPI02G12970 vs. NCBI nr
Match: gi|778674175|ref|XP_011650154.1| (PREDICTED: auxin-induced protein 15A-like [Cucumis sativus]) HSP 1 Score: 168.7 bits (426), Expect = 5.1e-39 Identity = 77/97 (79.38%), Postives = 87/97 (89.69%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |