CmoCh16G004270 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGGACAAACAGAAGGTGACTGTAACTGGATATGTAGAAGAAAGAAAAGTACTAAAGAAGGTGAGAGGAACGGGGCGAAAAGCCGAGCTATGGCCGTTCCCTTACGACAGTGAATACTATCCATACGCGTCGCAATACTACGACGAATCGACGTATGCGTCGACGTATAATTATTACAGGCATGGTTTTAATGAAGGCGTCCATGGATACTTCCCAGATCCTTTATATTCAACTGTTAGTGATAACACTGTTCATCTTTTTAGTGAAGATAATGTCCATGCTTATTGTAGTGTTATGTGA ATGGACAAACAGAAGGTGACTGTAACTGGATATGTAGAAGAAAGAAAAGTACTAAAGAAGGTGAGAGGAACGGGGCGAAAAGCCGAGCTATGGCCGTTCCCTTACGACAGTGAATACTATCCATACGCGTCGCAATACTACGACGAATCGACGTATGCGTCGACGTATAATTATTACAGGCATGGTTTTAATGAAGGCGTCCATGGATACTTCCCAGATCCTTTATATTCAACTGTTAGTGATAACACTGTTCATCTTTTTAGTGAAGATAATGTCCATGCTTATTGTAGTGTTATGTGA ATGGACAAACAGAAGGTGACTGTAACTGGATATGTAGAAGAAAGAAAAGTACTAAAGAAGGTGAGAGGAACGGGGCGAAAAGCCGAGCTATGGCCGTTCCCTTACGACAGTGAATACTATCCATACGCGTCGCAATACTACGACGAATCGACGTATGCGTCGACGTATAATTATTACAGGCATGGTTTTAATGAAGGCGTCCATGGATACTTCCCAGATCCTTTATATTCAACTGTTAGTGATAACACTGTTCATCTTTTTAGTGAAGATAATGTCCATGCTTATTGTAGTGTTATGTGA
BLAST of CmoCh16G004270 vs. Swiss-Prot
Match: HIP21_ARATH (Heavy metal-associated isoprenylated plant protein 21 OS=Arabidopsis thaliana GN=HIPP21 PE=2 SV=1) HSP 1 Score: 68.6 bits (166), Expect = 4.5e-11 Identity = 39/98 (39.80%), Postives = 54/98 (55.10%), Query Frame = 1
BLAST of CmoCh16G004270 vs. Swiss-Prot
Match: HIP20_ARATH (Heavy metal-associated isoprenylated plant protein 20 OS=Arabidopsis thaliana GN=HIPP20 PE=2 SV=1) HSP 1 Score: 58.9 bits (141), Expect = 3.6e-08 Identity = 39/96 (40.62%), Postives = 56/96 (58.33%), Query Frame = 1
BLAST of CmoCh16G004270 vs. Swiss-Prot
Match: HIP22_ARATH (Heavy metal-associated isoprenylated plant protein 22 OS=Arabidopsis thaliana GN=HIPP22 PE=2 SV=1) HSP 1 Score: 55.1 bits (131), Expect = 5.2e-07 Identity = 40/97 (41.24%), Postives = 54/97 (55.67%), Query Frame = 1
BLAST of CmoCh16G004270 vs. TrEMBL
Match: A0A0A0L9G7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G231930 PE=4 SV=1) HSP 1 Score: 203.4 bits (516), Expect = 1.3e-49 Identity = 95/99 (95.96%), Postives = 97/99 (97.98%), Query Frame = 1
BLAST of CmoCh16G004270 vs. TrEMBL
Match: W9SW68_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_027991 PE=4 SV=1) HSP 1 Score: 182.2 bits (461), Expect = 3.1e-43 Identity = 84/99 (84.85%), Postives = 90/99 (90.91%), Query Frame = 1
BLAST of CmoCh16G004270 vs. TrEMBL
Match: A0A061EYX8_THECC (Heavy metal transport/detoxification superfamily protein isoform 2 OS=Theobroma cacao GN=TCM_025236 PE=4 SV=1) HSP 1 Score: 181.0 bits (458), Expect = 6.9e-43 Identity = 84/99 (84.85%), Postives = 91/99 (91.92%), Query Frame = 1
BLAST of CmoCh16G004270 vs. TrEMBL
Match: A0A061EZK6_THECC (Heavy metal transport/detoxification superfamily protein isoform 1 OS=Theobroma cacao GN=TCM_025236 PE=4 SV=1) HSP 1 Score: 181.0 bits (458), Expect = 6.9e-43 Identity = 84/99 (84.85%), Postives = 91/99 (91.92%), Query Frame = 1
BLAST of CmoCh16G004270 vs. TrEMBL
Match: M5VSE8_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa013392mg PE=4 SV=1) HSP 1 Score: 178.3 bits (451), Expect = 4.5e-42 Identity = 82/99 (82.83%), Postives = 91/99 (91.92%), Query Frame = 1
BLAST of CmoCh16G004270 vs. TAIR10
Match: AT3G56891.1 (AT3G56891.1 Heavy metal transport/detoxification superfamily protein ) HSP 1 Score: 86.7 bits (213), Expect = 9.0e-18 Identity = 48/118 (40.68%), Postives = 74/118 (62.71%), Query Frame = 1
BLAST of CmoCh16G004270 vs. TAIR10
Match: AT2G18196.1 (AT2G18196.1 Heavy metal transport/detoxification superfamily protein ) HSP 1 Score: 76.6 bits (187), Expect = 9.3e-15 Identity = 42/102 (41.18%), Postives = 64/102 (62.75%), Query Frame = 1
BLAST of CmoCh16G004270 vs. TAIR10
Match: AT1G06330.1 (AT1G06330.1 Heavy metal transport/detoxification superfamily protein ) HSP 1 Score: 69.7 bits (169), Expect = 1.1e-12 Identity = 45/116 (38.79%), Postives = 70/116 (60.34%), Query Frame = 1
BLAST of CmoCh16G004270 vs. TAIR10
Match: AT5G17450.1 (AT5G17450.1 Heavy metal transport/detoxification superfamily protein ) HSP 1 Score: 68.6 bits (166), Expect = 2.5e-12 Identity = 39/98 (39.80%), Postives = 54/98 (55.10%), Query Frame = 1
BLAST of CmoCh16G004270 vs. TAIR10
Match: AT1G29100.1 (AT1G29100.1 Heavy metal transport/detoxification superfamily protein ) HSP 1 Score: 64.3 bits (155), Expect = 4.8e-11 Identity = 40/110 (36.36%), Postives = 62/110 (56.36%), Query Frame = 1
BLAST of CmoCh16G004270 vs. NCBI nr
Match: gi|449457031|ref|XP_004146252.1| (PREDICTED: heavy metal-associated isoprenylated plant protein 26 [Cucumis sativus]) HSP 1 Score: 203.4 bits (516), Expect = 1.9e-49 Identity = 95/99 (95.96%), Postives = 97/99 (97.98%), Query Frame = 1
BLAST of CmoCh16G004270 vs. NCBI nr
Match: gi|659112036|ref|XP_008456034.1| (PREDICTED: heavy metal-associated isoprenylated plant protein 26 [Cucumis melo]) HSP 1 Score: 203.4 bits (516), Expect = 1.9e-49 Identity = 95/99 (95.96%), Postives = 98/99 (98.99%), Query Frame = 1
BLAST of CmoCh16G004270 vs. NCBI nr
Match: gi|645270862|ref|XP_008240650.1| (PREDICTED: copper transport protein ATX1 [Prunus mume]) HSP 1 Score: 182.6 bits (462), Expect = 3.4e-43 Identity = 84/99 (84.85%), Postives = 92/99 (92.93%), Query Frame = 1
BLAST of CmoCh16G004270 vs. NCBI nr
Match: gi|703155937|ref|XP_010111334.1| (hypothetical protein L484_027991 [Morus notabilis]) HSP 1 Score: 182.2 bits (461), Expect = 4.5e-43 Identity = 84/99 (84.85%), Postives = 90/99 (90.91%), Query Frame = 1
BLAST of CmoCh16G004270 vs. NCBI nr
Match: gi|590638344|ref|XP_007029366.1| (Heavy metal transport/detoxification superfamily protein isoform 2 [Theobroma cacao]) HSP 1 Score: 181.0 bits (458), Expect = 1.0e-42 Identity = 84/99 (84.85%), Postives = 91/99 (91.92%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|