CmoCh14G021980 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGGCGGTGGAGAGAGACGACGCCAGCACTCCGGCGCCGGCGTCCCCAAAGGCTGCTTGGCGGTCCGAGTGGGGCAGAAGGAGGAAGAGCAGCAGAGATTTGTGGTGCCGGTTATGTACTTCAATCACCCGCGCTTCATGCAACTTCTCAAGGAGGCGGAGGAGGAGTACGGATTCGATCAGAAAGGGACCATCGCCATTCCTTGCCACGTCGAGGAGTTCCGCCACGTCCAGGGCATGATTGACCGTGAAAATTCATTCCACCGCCGTCACCACCACCACCACGTCGGTTGCTTTCGGGTTTCATTCTGA ATGGGCGGTGGAGAGAGACGACGCCAGCACTCCGGCGCCGGCGTCCCCAAAGGCTGCTTGGCGGTCCGAGTGGGGCAGAAGGAGGAAGAGCAGCAGAGATTTGTGGTGCCGGTTATGTACTTCAATCACCCGCGCTTCATGCAACTTCTCAAGGAGGCGGAGGAGGAGTACGGATTCGATCAGAAAGGGACCATCGCCATTCCTTGCCACGTCGAGGAGTTCCGCCACGTCCAGGGCATGATTGACCGTGAAAATTCATTCCACCGCCGTCACCACCACCACCACGTCGGTTGCTTTCGGGTTTCATTCTGA ATGGGCGGTGGAGAGAGACGACGCCAGCACTCCGGCGCCGGCGTCCCCAAAGGCTGCTTGGCGGTCCGAGTGGGGCAGAAGGAGGAAGAGCAGCAGAGATTTGTGGTGCCGGTTATGTACTTCAATCACCCGCGCTTCATGCAACTTCTCAAGGAGGCGGAGGAGGAGTACGGATTCGATCAGAAAGGGACCATCGCCATTCCTTGCCACGTCGAGGAGTTCCGCCACGTCCAGGGCATGATTGACCGTGAAAATTCATTCCACCGCCGTCACCACCACCACCACGTCGGTTGCTTTCGGGTTTCATTCTGA
BLAST of CmoCh14G021980 vs. Swiss-Prot
Match: SAU32_ARATH (Auxin-responsive protein SAUR32 OS=Arabidopsis thaliana GN=SAUR32 PE=2 SV=1) HSP 1 Score: 138.3 bits (347), Expect = 4.8e-32 Identity = 67/97 (69.07%), Postives = 77/97 (79.38%), Query Frame = 1
BLAST of CmoCh14G021980 vs. Swiss-Prot
Match: SAU36_ARATH (Auxin-responsive protein SAUR36 OS=Arabidopsis thaliana GN=SAUR36 PE=2 SV=1) HSP 1 Score: 77.4 bits (189), Expect = 1.0e-13 Identity = 35/67 (52.24%), Postives = 48/67 (71.64%), Query Frame = 1
BLAST of CmoCh14G021980 vs. Swiss-Prot
Match: SAU15_ARATH (Auxin-responsive protein SAUR15 OS=Arabidopsis thaliana GN=SAUR15 PE=2 SV=1) HSP 1 Score: 68.2 bits (165), Expect = 6.1e-11 Identity = 32/80 (40.00%), Postives = 50/80 (62.50%), Query Frame = 1
BLAST of CmoCh14G021980 vs. Swiss-Prot
Match: AXX15_SOYBN (Auxin-induced protein X15 OS=Glycine max PE=2 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 5.2e-10 Identity = 33/72 (45.83%), Postives = 44/72 (61.11%), Query Frame = 1
BLAST of CmoCh14G021980 vs. Swiss-Prot
Match: A10A5_SOYBN (Auxin-induced protein 10A5 OS=Glycine max PE=2 SV=1) HSP 1 Score: 64.3 bits (155), Expect = 8.9e-10 Identity = 33/64 (51.56%), Postives = 41/64 (64.06%), Query Frame = 1
BLAST of CmoCh14G021980 vs. TrEMBL
Match: A0A0A0L5S7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G118740 PE=4 SV=1) HSP 1 Score: 193.7 bits (491), Expect = 1.1e-46 Identity = 97/112 (86.61%), Postives = 99/112 (88.39%), Query Frame = 1
BLAST of CmoCh14G021980 vs. TrEMBL
Match: A0A0D2SYI3_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_008G128100 PE=4 SV=1) HSP 1 Score: 155.6 bits (392), Expect = 3.3e-35 Identity = 72/90 (80.00%), Postives = 79/90 (87.78%), Query Frame = 1
BLAST of CmoCh14G021980 vs. TrEMBL
Match: A0A0D2QRQ4_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_004G044200 PE=4 SV=1) HSP 1 Score: 155.6 bits (392), Expect = 3.3e-35 Identity = 70/90 (77.78%), Postives = 81/90 (90.00%), Query Frame = 1
BLAST of CmoCh14G021980 vs. TrEMBL
Match: E5GCM6_CUCME (Auxin-responsive family protein OS=Cucumis melo subsp. melo PE=4 SV=1) HSP 1 Score: 153.7 bits (387), Expect = 1.2e-34 Identity = 74/102 (72.55%), Postives = 85/102 (83.33%), Query Frame = 1
BLAST of CmoCh14G021980 vs. TrEMBL
Match: M5X0E8_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa010986mg PE=4 SV=1) HSP 1 Score: 153.3 bits (386), Expect = 1.6e-34 Identity = 74/90 (82.22%), Postives = 79/90 (87.78%), Query Frame = 1
BLAST of CmoCh14G021980 vs. TAIR10
Match: AT2G46690.1 (AT2G46690.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 138.3 bits (347), Expect = 2.7e-33 Identity = 67/97 (69.07%), Postives = 77/97 (79.38%), Query Frame = 1
BLAST of CmoCh14G021980 vs. TAIR10
Match: AT4G00880.1 (AT4G00880.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 136.7 bits (343), Expect = 7.9e-33 Identity = 68/102 (66.67%), Postives = 78/102 (76.47%), Query Frame = 1
BLAST of CmoCh14G021980 vs. TAIR10
Match: AT3G61900.1 (AT3G61900.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 129.0 bits (323), Expect = 1.6e-30 Identity = 59/78 (75.64%), Postives = 67/78 (85.90%), Query Frame = 1
BLAST of CmoCh14G021980 vs. TAIR10
Match: AT5G53590.1 (AT5G53590.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 98.2 bits (243), Expect = 3.1e-21 Identity = 50/104 (48.08%), Postives = 68/104 (65.38%), Query Frame = 1
BLAST of CmoCh14G021980 vs. TAIR10
Match: AT3G60690.1 (AT3G60690.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 84.7 bits (208), Expect = 3.6e-17 Identity = 38/73 (52.05%), Postives = 53/73 (72.60%), Query Frame = 1
BLAST of CmoCh14G021980 vs. NCBI nr
Match: gi|449432006|ref|XP_004133791.1| (PREDICTED: auxin-induced protein X15-like [Cucumis sativus]) HSP 1 Score: 193.7 bits (491), Expect = 1.5e-46 Identity = 97/112 (86.61%), Postives = 99/112 (88.39%), Query Frame = 1
BLAST of CmoCh14G021980 vs. NCBI nr
Match: gi|470141830|ref|XP_004306629.1| (PREDICTED: auxin-induced protein X15-like [Fragaria vesca subsp. vesca]) HSP 1 Score: 157.9 bits (398), Expect = 9.4e-36 Identity = 74/96 (77.08%), Postives = 83/96 (86.46%), Query Frame = 1
BLAST of CmoCh14G021980 vs. NCBI nr
Match: gi|1009142561|ref|XP_015888787.1| (PREDICTED: auxin-responsive protein SAUR32-like [Ziziphus jujuba]) HSP 1 Score: 156.0 bits (393), Expect = 3.6e-35 Identity = 72/87 (82.76%), Postives = 79/87 (90.80%), Query Frame = 1
BLAST of CmoCh14G021980 vs. NCBI nr
Match: gi|823146956|ref|XP_012473385.1| (PREDICTED: auxin-induced protein X15-like [Gossypium raimondii]) HSP 1 Score: 155.6 bits (392), Expect = 4.7e-35 Identity = 70/90 (77.78%), Postives = 81/90 (90.00%), Query Frame = 1
BLAST of CmoCh14G021980 vs. NCBI nr
Match: gi|823208982|ref|XP_012437801.1| (PREDICTED: auxin-induced protein X15-like [Gossypium raimondii]) HSP 1 Score: 155.6 bits (392), Expect = 4.7e-35 Identity = 72/90 (80.00%), Postives = 79/90 (87.78%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene: The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene:
|