CmoCh03G001840 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCTCTAGCATCTGTTGATGGAAGATCAAAGCTAAACCCGAACGCCCCACTTTTCATCCCGGCTGCATACCAGGTGGAGGACTTCTCCCCGCAATGGTGGCAATTGGTCACAACCTCGACATGGTACCGCAATTACTGGCTCAGCCAACACCAGGAAGACGGTGACTTCTACATGGACGGCGAAGATGATTTGAGTAACGACATTGCTGATTTTTTGCCAGAGGCATTCGATCTCGATGCAAATGAAGAACTGCGCACCATGGAAGCTGAATTTGAGGAGTTCATTCAAGCTTCCCTTACTGAAGGGTACCACCTCGAGAAGTAG ATGGCTCTAGCATCTGTTGATGGAAGATCAAAGCTAAACCCGAACGCCCCACTTTTCATCCCGGCTGCATACCAGGTGGAGGACTTCTCCCCGCAATGGTGGCAATTGGTCACAACCTCGACATGGTACCGCAATTACTGGCTCAGCCAACACCAGGAAGACGGTGACTTCTACATGGACGGCGAAGATGATTTGAGTAACGACATTGCTGATTTTTTGCCAGAGGCATTCGATCTCGATGCAAATGAAGAACTGCGCACCATGGAAGCTGAATTTGAGGAGTTCATTCAAGCTTCCCTTACTGAAGGGTACCACCTCGAGAAGTAG ATGGCTCTAGCATCTGTTGATGGAAGATCAAAGCTAAACCCGAACGCCCCACTTTTCATCCCGGCTGCATACCAGGTGGAGGACTTCTCCCCGCAATGGTGGCAATTGGTCACAACCTCGACATGGTACCGCAATTACTGGCTCAGCCAACACCAGGAAGACGGTGACTTCTACATGGACGGCGAAGATGATTTGAGTAACGACATTGCTGATTTTTTGCCAGAGGCATTCGATCTCGATGCAAATGAAGAACTGCGCACCATGGAAGCTGAATTTGAGGAGTTCATTCAAGCTTCCCTTACTGAAGGGTACCACCTCGAGAAGTAG
BLAST of CmoCh03G001840 vs. Swiss-Prot
Match: ERD15_ARATH (Protein EARLY RESPONSIVE TO DEHYDRATION 15 OS=Arabidopsis thaliana GN=ERD15 PE=1 SV=1) HSP 1 Score: 102.8 bits (255), Expect = 2.4e-21 Identity = 58/99 (58.59%), Postives = 72/99 (72.73%), Query Frame = 1
BLAST of CmoCh03G001840 vs. Swiss-Prot
Match: CID2_ARATH (Polyadenylate-binding protein-interacting protein 2 OS=Arabidopsis thaliana GN=CID2 PE=2 SV=1) HSP 1 Score: 70.9 bits (172), Expect = 9.9e-12 Identity = 44/98 (44.90%), Postives = 57/98 (58.16%), Query Frame = 1
BLAST of CmoCh03G001840 vs. TrEMBL
Match: Q6ELF8_CUCSA (Poly(A)-binding protein C-terminal interacting protein 243 OS=Cucumis sativus GN=Csa_4G214830 PE=2 SV=1) HSP 1 Score: 201.1 bits (510), Expect = 7.1e-49 Identity = 98/110 (89.09%), Postives = 103/110 (93.64%), Query Frame = 1
BLAST of CmoCh03G001840 vs. TrEMBL
Match: W9S851_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_015513 PE=4 SV=1) HSP 1 Score: 140.2 bits (352), Expect = 1.5e-30 Identity = 69/104 (66.35%), Postives = 83/104 (79.81%), Query Frame = 1
BLAST of CmoCh03G001840 vs. TrEMBL
Match: A0A067K1V9_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_22456 PE=4 SV=1) HSP 1 Score: 135.6 bits (340), Expect = 3.6e-29 Identity = 67/105 (63.81%), Postives = 84/105 (80.00%), Query Frame = 1
BLAST of CmoCh03G001840 vs. TrEMBL
Match: A0A061EXG3_THECC (Dehydration-induced protein, putative OS=Theobroma cacao GN=TCM_024484 PE=4 SV=1) HSP 1 Score: 134.8 bits (338), Expect = 6.2e-29 Identity = 69/101 (68.32%), Postives = 81/101 (80.20%), Query Frame = 1
BLAST of CmoCh03G001840 vs. TrEMBL
Match: B9SVS1_RICCO (Putative uncharacterized protein OS=Ricinus communis GN=RCOM_0255020 PE=4 SV=1) HSP 1 Score: 133.7 bits (335), Expect = 1.4e-28 Identity = 70/111 (63.06%), Postives = 82/111 (73.87%), Query Frame = 1
BLAST of CmoCh03G001840 vs. TAIR10
Match: AT2G41430.1 (AT2G41430.1 dehydration-induced protein (ERD15)) HSP 1 Score: 102.8 bits (255), Expect = 1.3e-22 Identity = 58/99 (58.59%), Postives = 72/99 (72.73%), Query Frame = 1
BLAST of CmoCh03G001840 vs. TAIR10
Match: AT4G14270.1 (AT4G14270.1 Protein containing PAM2 motif which mediates interaction with the PABC domain of polyadenyl binding proteins.) HSP 1 Score: 70.9 bits (172), Expect = 5.6e-13 Identity = 44/98 (44.90%), Postives = 57/98 (58.16%), Query Frame = 1
BLAST of CmoCh03G001840 vs. NCBI nr
Match: gi|525507437|ref|NP_001267508.1| (protein EARLY RESPONSIVE TO DEHYDRATION 15-like [Cucumis sativus]) HSP 1 Score: 201.1 bits (510), Expect = 1.0e-48 Identity = 98/110 (89.09%), Postives = 103/110 (93.64%), Query Frame = 1
BLAST of CmoCh03G001840 vs. NCBI nr
Match: gi|703123054|ref|XP_010102715.1| (hypothetical protein L484_015513 [Morus notabilis]) HSP 1 Score: 140.2 bits (352), Expect = 2.1e-30 Identity = 69/104 (66.35%), Postives = 83/104 (79.81%), Query Frame = 1
BLAST of CmoCh03G001840 vs. NCBI nr
Match: gi|802725118|ref|XP_012085962.1| (PREDICTED: protein EARLY RESPONSIVE TO DEHYDRATION 15 [Jatropha curcas]) HSP 1 Score: 135.6 bits (340), Expect = 5.2e-29 Identity = 67/105 (63.81%), Postives = 84/105 (80.00%), Query Frame = 1
BLAST of CmoCh03G001840 vs. NCBI nr
Match: gi|590635295|ref|XP_007028595.1| (Dehydration-induced protein, putative [Theobroma cacao]) HSP 1 Score: 134.8 bits (338), Expect = 8.9e-29 Identity = 69/101 (68.32%), Postives = 81/101 (80.20%), Query Frame = 1
BLAST of CmoCh03G001840 vs. NCBI nr
Match: gi|657999865|ref|XP_008392368.1| (PREDICTED: protein EARLY RESPONSIVE TO DEHYDRATION 15-like isoform X4 [Malus domestica]) HSP 1 Score: 134.4 bits (337), Expect = 1.2e-28 Identity = 67/103 (65.05%), Postives = 81/103 (78.64%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene:
|