Carg24681 (gene) Silver-seed gourd
The following sequences are available for this feature:
Legend: polypeptideexonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCTTCAAGCTCTTTGAAGCATCTCCGACCGGAAGCGATGTGGACGACAAAGCAGAACAAGCTGTTTGAGATGGCATTGGCTTTGTACGACAAAGAGACGCCCGAGAGATGGCAGAACGTTGCCAAGGCCGTCAGCGGGAAGTCGGCAGACGAAGTCGAAAGACACTATGAGATACTCTTGGAAGATCTCCAGCGGATTGAGTCGGGGTGTGTTCCTATTCCAAATTATAGAGCTGCCGGAAATGGAGATGAAGAATTGAGGTTAGTGATGAAGATGATCAAAGATATGAAATATGGTTTATAA ATGGCTTCAAGCTCTTTGAAGCATCTCCGACCGGAAGCGATGTGGACGACAAAGCAGAACAAGCTGTTTGAGATGGCATTGGCTTTGTACGACAAAGAGACGCCCGAGAGATGGCAGAACGTTGCCAAGGCCGTCAGCGGGAAGTCGGCAGACGAAGTCGAAAGACACTATGAGATACTCTTGGAAGATCTCCAGCGGATTGAGTCGGGGTGTGTTCCTATTCCAAATTATAGAGCTGCCGGAAATGGAGATGAAGAATTGAGGTTAGTGATGAAGATGATCAAAGATATGAAATATGGTTTATAA ATGGCTTCAAGCTCTTTGAAGCATCTCCGACCGGAAGCGATGTGGACGACAAAGCAGAACAAGCTGTTTGAGATGGCATTGGCTTTGTACGACAAAGAGACGCCCGAGAGATGGCAGAACGTTGCCAAGGCCGTCAGCGGGAAGTCGGCAGACGAAGTCGAAAGACACTATGAGATACTCTTGGAAGATCTCCAGCGGATTGAGTCGGGGTGTGTTCCTATTCCAAATTATAGAGCTGCCGGAAATGGAGATGAAGAATTGAGGTTAGTGATGAAGATGATCAAAGATATGAAATATGGTTTATAA MASSSLKHLRPEAMWTTKQNKLFEMALALYDKETPERWQNVAKAVSGKSADEVERHYEILLEDLQRIESGCVPIPNYRAAGNGDEELRLVMKMIKDMKYGL
BLAST of Carg24681 vs. NCBI nr
Match: XP_022971553.1 (protein RADIALIS-like 3 [Cucurbita maxima]) HSP 1 Score: 184.1 bits (466), Expect = 2.3e-43 Identity = 89/93 (95.70%), Postives = 91/93 (97.85%), Query Frame = 0
BLAST of Carg24681 vs. NCBI nr
Match: XP_022933513.1 (protein RADIALIS-like 3 [Cucurbita moschata]) HSP 1 Score: 182.6 bits (462), Expect = 6.8e-43 Identity = 88/93 (94.62%), Postives = 91/93 (97.85%), Query Frame = 0
BLAST of Carg24681 vs. NCBI nr
Match: XP_023531644.1 (protein RADIALIS-like 3 [Cucurbita pepo subsp. pepo]) HSP 1 Score: 181.8 bits (460), Expect = 1.2e-42 Identity = 87/93 (93.55%), Postives = 90/93 (96.77%), Query Frame = 0
BLAST of Carg24681 vs. NCBI nr
Match: XP_023554816.1 (protein RADIALIS-like 3 [Cucurbita pepo subsp. pepo]) HSP 1 Score: 153.3 bits (386), Expect = 4.4e-34 Identity = 75/90 (83.33%), Postives = 79/90 (87.78%), Query Frame = 0
BLAST of Carg24681 vs. NCBI nr
Match: XP_022975322.1 (protein RADIALIS-like 3 [Cucurbita maxima]) HSP 1 Score: 152.5 bits (384), Expect = 7.5e-34 Identity = 75/90 (83.33%), Postives = 78/90 (86.67%), Query Frame = 0
BLAST of Carg24681 vs. TAIR10
Match: AT1G19510.1 (RAD-like 5) HSP 1 Score: 108.2 bits (269), Expect = 3.0e-24 Identity = 55/100 (55.00%), Postives = 71/100 (71.00%), Query Frame = 0
BLAST of Carg24681 vs. TAIR10
Match: AT4G39250.1 (RAD-like 1) HSP 1 Score: 105.1 bits (261), Expect = 2.5e-23 Identity = 48/81 (59.26%), Postives = 61/81 (75.31%), Query Frame = 0
BLAST of Carg24681 vs. TAIR10
Match: AT1G75250.1 (RAD-like 6) HSP 1 Score: 103.2 bits (256), Expect = 9.5e-23 Identity = 48/78 (61.54%), Postives = 62/78 (79.49%), Query Frame = 0
BLAST of Carg24681 vs. TAIR10
Match: AT2G21650.1 (Homeodomain-like superfamily protein) HSP 1 Score: 93.2 bits (230), Expect = 9.8e-20 Identity = 47/100 (47.00%), Postives = 67/100 (67.00%), Query Frame = 0
BLAST of Carg24681 vs. TAIR10
Match: AT2G18328.1 (RAD-like 4) HSP 1 Score: 93.2 bits (230), Expect = 9.8e-20 Identity = 44/78 (56.41%), Postives = 58/78 (74.36%), Query Frame = 0
BLAST of Carg24681 vs. Swiss-Prot
Match: sp|Q8GW75|RADL5_ARATH (Protein RADIALIS-like 5 OS=Arabidopsis thaliana OX=3702 GN=RL5 PE=3 SV=1) HSP 1 Score: 108.2 bits (269), Expect = 5.3e-23 Identity = 55/100 (55.00%), Postives = 71/100 (71.00%), Query Frame = 0
BLAST of Carg24681 vs. Swiss-Prot
Match: sp|F4JVB8|RADL1_ARATH (Protein RADIALIS-like 1 OS=Arabidopsis thaliana OX=3702 GN=RL1 PE=2 SV=1) HSP 1 Score: 105.1 bits (261), Expect = 4.5e-22 Identity = 48/81 (59.26%), Postives = 61/81 (75.31%), Query Frame = 0
BLAST of Carg24681 vs. Swiss-Prot
Match: sp|Q6NNN0|RADL3_ARATH (Protein RADIALIS-like 3 OS=Arabidopsis thaliana OX=3702 GN=RL3 PE=2 SV=1) HSP 1 Score: 104.8 bits (260), Expect = 5.9e-22 Identity = 50/82 (60.98%), Postives = 62/82 (75.61%), Query Frame = 0
BLAST of Carg24681 vs. Swiss-Prot
Match: sp|Q1A173|RADL6_ARATH (Protein RADIALIS-like 6 OS=Arabidopsis thaliana OX=3702 GN=RL6 PE=2 SV=1) HSP 1 Score: 103.2 bits (256), Expect = 1.7e-21 Identity = 48/78 (61.54%), Postives = 62/78 (79.49%), Query Frame = 0
BLAST of Carg24681 vs. Swiss-Prot
Match: sp|Q58FS3|RAD_ANTMA (Transcription factor RADIALIS OS=Antirrhinum majus OX=4151 GN=RAD PE=1 SV=1) HSP 1 Score: 99.8 bits (247), Expect = 1.9e-20 Identity = 42/67 (62.69%), Postives = 56/67 (83.58%), Query Frame = 0
BLAST of Carg24681 vs. TrEMBL
Match: tr|A0A0A0K2A2|A0A0A0K2A2_CUCSA (Uncharacterized protein OS=Cucumis sativus OX=3659 GN=Csa_7G000020 PE=4 SV=1) HSP 1 Score: 148.3 bits (373), Expect = 9.4e-33 Identity = 72/90 (80.00%), Postives = 77/90 (85.56%), Query Frame = 0
BLAST of Carg24681 vs. TrEMBL
Match: tr|A0A1S3BHB0|A0A1S3BHB0_CUCME (protein RADIALIS-like 3 OS=Cucumis melo OX=3656 GN=LOC103489572 PE=4 SV=1) HSP 1 Score: 147.1 bits (370), Expect = 2.1e-32 Identity = 71/90 (78.89%), Postives = 77/90 (85.56%), Query Frame = 0
BLAST of Carg24681 vs. TrEMBL
Match: tr|A0A061E6U2|A0A061E6U2_THECC (DnaJ subfamily C member 2 OS=Theobroma cacao OX=3641 GN=TCM_006875 PE=4 SV=1) HSP 1 Score: 128.3 bits (321), Expect = 1.0e-26 Identity = 63/88 (71.59%), Postives = 72/88 (81.82%), Query Frame = 0
BLAST of Carg24681 vs. TrEMBL
Match: tr|I1LJC8|I1LJC8_SOYBN (Uncharacterized protein OS=Glycine max OX=3847 GN=100798314 PE=4 SV=2) HSP 1 Score: 125.9 bits (315), Expect = 5.0e-26 Identity = 66/94 (70.21%), Postives = 75/94 (79.79%), Query Frame = 0
BLAST of Carg24681 vs. TrEMBL
Match: tr|A0A1U8ADR1|A0A1U8ADR1_NELNU (protein RADIALIS-like 3 OS=Nelumbo nucifera OX=4432 GN=LOC104601848 PE=4 SV=1) HSP 1 Score: 125.9 bits (315), Expect = 5.0e-26 Identity = 64/95 (67.37%), Postives = 77/95 (81.05%), Query Frame = 0
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of silver-seed gourd
Date Performed: 2019-03-07
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene:
|