Carg08609 (gene) Silver-seed gourd
The following sequences are available for this feature:
Legend: polypeptideCDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGTCGAATAGCGAGGAGGAGCAGCAACAGCAGCAGCAATTGGTGCGGGAGAAGGAAGAGAAGGATTCTGTGGAAGAATTGCTGCCATTGGAGAGCAGTCCGTACGTGAAATACAAAGACTTGGAGGAGTACAAAAGAAAAGGGTATGGGGCGGAGGGGCATCTTGAGCCCAAGCCCAACCAGGGCGGCGGTACTGACGCACCCACCTTGTCCGGCAGCGGCTTCCCGGAGGTGAAGCCCGCCACCATTGACTTCGTCACCAACCATGGCCTTCTCTCCTGA ATGTCGAATAGCGAGGAGGAGCAGCAACAGCAGCAGCAATTGGTGCGGGAGAAGGAAGAGAAGGATTCTGTGGAAGAATTGCTGCCATTGGAGAGCAGTCCGTACGTGAAATACAAAGACTTGGAGGAGTACAAAAGAAAAGGGTATGGGGCGGAGGGGCATCTTGAGCCCAAGCCCAACCAGGGCGGCGGTACTGACGCACCCACCTTGTCCGGCAGCGGCTTCCCGGAGGTGAAGCCCGCCACCATTGACTTCGTCACCAACCATGGCCTTCTCTCCTGA ATGTCGAATAGCGAGGAGGAGCAGCAACAGCAGCAGCAATTGGTGCGGGAGAAGGAAGAGAAGGATTCTGTGGAAGAATTGCTGCCATTGGAGAGCAGTCCGTACGTGAAATACAAAGACTTGGAGGAGTACAAAAGAAAAGGGTATGGGGCGGAGGGGCATCTTGAGCCCAAGCCCAACCAGGGCGGCGGTACTGACGCACCCACCTTGTCCGGCAGCGGCTTCCCGGAGGTGAAGCCCGCCACCATTGACTTCGTCACCAACCATGGCCTTCTCTCCTGA MSNSEEEQQQQQQLVREKEEKDSVEELLPLESSPYVKYKDLEEYKRKGYGAEGHLEPKPNQGGGTDAPTLSGSGFPEVKPATIDFVTNHGLLS
BLAST of Carg08609 vs. NCBI nr
Match: XP_022937316.1 (uncharacterized protein LOC111443639 [Cucurbita moschata]) HSP 1 Score: 148.7 bits (374), Expect = 1.0e-32 Identity = 71/71 (100.00%), Postives = 71/71 (100.00%), Query Frame = 0
BLAST of Carg08609 vs. NCBI nr
Match: XP_023535424.1 (uncharacterized protein LOC111796868 [Cucurbita pepo subsp. pepo]) HSP 1 Score: 147.1 bits (370), Expect = 2.9e-32 Identity = 70/70 (100.00%), Postives = 70/70 (100.00%), Query Frame = 0
BLAST of Carg08609 vs. NCBI nr
Match: XP_022135734.1 (uncharacterized protein LOC111007621 [Momordica charantia]) HSP 1 Score: 129.8 bits (325), Expect = 4.8e-27 Identity = 63/73 (86.30%), Postives = 67/73 (91.78%), Query Frame = 0
BLAST of Carg08609 vs. NCBI nr
Match: KGN55531.1 (hypothetical protein Csa_4G664380 [Cucumis sativus]) HSP 1 Score: 126.3 bits (316), Expect = 5.3e-26 Identity = 59/69 (85.51%), Postives = 62/69 (89.86%), Query Frame = 0
BLAST of Carg08609 vs. NCBI nr
Match: XP_002533168.1 (uncharacterized protein LOC8261670 [Ricinus communis] >EEF29227.1 conserved hypothetical protein [Ricinus communis]) HSP 1 Score: 87.8 bits (216), Expect = 2.1e-14 Identity = 41/68 (60.29%), Postives = 55/68 (80.88%), Query Frame = 0
BLAST of Carg08609 vs. TAIR10
Match: AT2G33690.1 (Late embryogenesis abundant protein, group 6) HSP 1 Score: 64.7 bits (156), Expect = 3.4e-11 Identity = 30/50 (60.00%), Postives = 36/50 (72.00%), Query Frame = 0
BLAST of Carg08609 vs. TAIR10
Match: AT2G23110.1 (Late embryogenesis abundant protein, group 6) HSP 1 Score: 56.2 bits (134), Expect = 1.2e-08 Identity = 27/41 (65.85%), Postives = 32/41 (78.05%), Query Frame = 0
BLAST of Carg08609 vs. TAIR10
Match: AT2G23120.1 (Late embryogenesis abundant protein, group 6) HSP 1 Score: 52.0 bits (123), Expect = 2.3e-07 Identity = 27/41 (65.85%), Postives = 29/41 (70.73%), Query Frame = 0
BLAST of Carg08609 vs. TrEMBL
Match: tr|A0A0A0L5Y6|A0A0A0L5Y6_CUCSA (Uncharacterized protein OS=Cucumis sativus OX=3659 GN=Csa_4G664380 PE=4 SV=1) HSP 1 Score: 126.3 bits (316), Expect = 3.5e-26 Identity = 59/69 (85.51%), Postives = 62/69 (89.86%), Query Frame = 0
BLAST of Carg08609 vs. TrEMBL
Match: tr|B9T4J9|B9T4J9_RICCO (Uncharacterized protein OS=Ricinus communis OX=3988 GN=RCOM_0396800 PE=4 SV=1) HSP 1 Score: 87.8 bits (216), Expect = 1.4e-14 Identity = 41/68 (60.29%), Postives = 55/68 (80.88%), Query Frame = 0
BLAST of Carg08609 vs. TrEMBL
Match: tr|F6I6V2|F6I6V2_VITVI (Uncharacterized protein OS=Vitis vinifera OX=29760 GN=VIT_18s0122g00820 PE=4 SV=1) HSP 1 Score: 85.5 bits (210), Expect = 6.9e-14 Identity = 40/65 (61.54%), Postives = 50/65 (76.92%), Query Frame = 0
BLAST of Carg08609 vs. TrEMBL
Match: tr|A0A2R6PAW1|A0A2R6PAW1_ACTCH (mRNA cap guanine-N7 methyltransferase OS=Actinidia chinensis var. chinensis OX=1590841 GN=CEY00_Acc30967 PE=4 SV=1) HSP 1 Score: 85.1 bits (209), Expect = 9.0e-14 Identity = 39/67 (58.21%), Postives = 50/67 (74.63%), Query Frame = 0
BLAST of Carg08609 vs. TrEMBL
Match: tr|E5FHZ6|E5FHZ6_ARAHY (Late embryogenesis abundant protein group 8 protein OS=Arachis hypogaea OX=3818 GN=LEA8-1 PE=2 SV=1) HSP 1 Score: 83.2 bits (204), Expect = 3.4e-13 Identity = 40/52 (76.92%), Postives = 44/52 (84.62%), Query Frame = 0
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of silver-seed gourd
Date Performed: 2019-03-07
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene:
|