CSPI07G21300 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGTGTTATCCAACCCTTCCCTTTCACAGACCCACCGCCTTCAGCTTCGCCAGCCACGGAAGGTCGGTTGTAGCGGCGGTGGAAGAGGCCGTCCGGCAGCAGAGAAGTGGCGGTGGATACAAGTGTATTTGCTCGCCGACGACTCACCCAGGTTCTTTCAAATGTAGATTTCATCAAGGAGATTATAAATGGGTTAGTCGGTCCACAACATCAAAAGCAAAAACAGTTTAA ATGTGTTATCCAACCCTTCCCTTTCACAGACCCACCGCCTTCAGCTTCGCCAGCCACGGAAGGTCGGTTGTAGCGGCGGTGGAAGAGGCCGTCCGGCAGCAGAGAAGTGGCGGTGGATACAAGTGTATTTGCTCGCCGACGACTCACCCAGGTTCTTTCAAATGTAGATTTCATCAAGGAGATTATAAATGGGTTAGTCGGTCCACAACATCAAAAGCAAAAACAGTTTAA ATGTGTTATCCAACCCTTCCCTTTCACAGACCCACCGCCTTCAGCTTCGCCAGCCACGGAAGGTCGGTTGTAGCGGCGGTGGAAGAGGCCGTCCGGCAGCAGAGAAGTGGCGGTGGATACAAGTGTATTTGCTCGCCGACGACTCACCCAGGTTCTTTCAAATGTAGATTTCATCAAGGAGATTATAAATGGGTTAGTCGGTCCACAACATCAAAAGCAAAAACAGTTTAA
BLAST of CSPI07G21300 vs. TrEMBL
Match: A0A0A0KAE1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G446750 PE=4 SV=1) HSP 1 Score: 165.2 bits (417), Expect = 3.1e-38 Identity = 75/75 (100.00%), Postives = 75/75 (100.00%), Query Frame = 1
BLAST of CSPI07G21300 vs. TrEMBL
Match: D7KJG0_ARALL (Putative uncharacterized protein OS=Arabidopsis lyrata subsp. lyrata GN=ARALYDRAFT_474355 PE=4 SV=1) HSP 1 Score: 65.5 bits (158), Expect = 3.3e-08 Identity = 37/82 (45.12%), Postives = 46/82 (56.10%), Query Frame = 1
BLAST of CSPI07G21300 vs. TrEMBL
Match: A0A078EN61_BRANA (BnaA08g01490D protein OS=Brassica napus GN=BnaA08g01490D PE=4 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 6.2e-07 Identity = 33/82 (40.24%), Postives = 43/82 (52.44%), Query Frame = 1
BLAST of CSPI07G21300 vs. TrEMBL
Match: R0GN87_9BRAS (Uncharacterized protein OS=Capsella rubella GN=CARUB_v10010773mg PE=4 SV=1) HSP 1 Score: 60.8 bits (146), Expect = 8.1e-07 Identity = 35/82 (42.68%), Postives = 47/82 (57.32%), Query Frame = 1
BLAST of CSPI07G21300 vs. TrEMBL
Match: M1A3Y9_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400005605 PE=4 SV=1) HSP 1 Score: 60.5 bits (145), Expect = 1.1e-06 Identity = 28/70 (40.00%), Postives = 41/70 (58.57%), Query Frame = 1
BLAST of CSPI07G21300 vs. TAIR10
Match: AT1G52342.1 (AT1G52342.1 unknown protein) HSP 1 Score: 60.1 bits (144), Expect = 7.0e-10 Identity = 29/83 (34.94%), Postives = 41/83 (49.40%), Query Frame = 1
BLAST of CSPI07G21300 vs. TAIR10
Match: AT1G67910.1 (AT1G67910.1 unknown protein) HSP 1 Score: 47.4 bits (111), Expect = 4.7e-06 Identity = 20/42 (47.62%), Postives = 25/42 (59.52%), Query Frame = 1
BLAST of CSPI07G21300 vs. NCBI nr
Match: gi|700190124|gb|KGN45357.1| (hypothetical protein Csa_7G446750 [Cucumis sativus]) HSP 1 Score: 165.2 bits (417), Expect = 4.4e-38 Identity = 75/75 (100.00%), Postives = 75/75 (100.00%), Query Frame = 1
BLAST of CSPI07G21300 vs. NCBI nr
Match: gi|727438966|ref|XP_010500835.1| (PREDICTED: uncharacterized protein LOC104778157 [Camelina sativa]) HSP 1 Score: 65.9 bits (159), Expect = 3.6e-08 Identity = 32/85 (37.65%), Postives = 47/85 (55.29%), Query Frame = 1
BLAST of CSPI07G21300 vs. NCBI nr
Match: gi|297852990|ref|XP_002894376.1| (hypothetical protein ARALYDRAFT_474355 [Arabidopsis lyrata subsp. lyrata]) HSP 1 Score: 65.5 bits (158), Expect = 4.7e-08 Identity = 37/82 (45.12%), Postives = 46/82 (56.10%), Query Frame = 1
BLAST of CSPI07G21300 vs. NCBI nr
Match: gi|727615045|ref|XP_010479743.1| (PREDICTED: uncharacterized protein LOC104758556 [Camelina sativa]) HSP 1 Score: 62.8 bits (151), Expect = 3.1e-07 Identity = 32/85 (37.65%), Postives = 47/85 (55.29%), Query Frame = 1
BLAST of CSPI07G21300 vs. NCBI nr
Match: gi|727578772|ref|XP_010462072.1| (PREDICTED: uncharacterized protein LOC104742739 [Camelina sativa]) HSP 1 Score: 62.4 bits (150), Expect = 4.0e-07 Identity = 32/83 (38.55%), Postives = 46/83 (55.42%), Query Frame = 1
The following BLAST results are available for this feature:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |