CSPI06G14890 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: five_prime_UTRCDSthree_prime_UTR Hold the cursor over a type above to highlight its positions in the sequence below.CTCCCTTCTTCATTCCTCACTTCATTCTCAACCATTTTCTTCTTCTATTTCCTTCTCTGTTTTCTTAACCTCTCAAACTACATATACAATGGAGACTGTCAACAAGTTGGTTTCTGATAGGCCGGTGGTAGTTTTCAGCAAGAATAGTTGCTGTATGAGCCACTCTATCAAGACACTCTTGTGTGATTTCGGAGTTAACCCGACGGTGTACGAGCTCGATGAGCTTCCCAGAGGGAAAGAGATAGAGCAAGCTCTTCTTCGGATTGGCTGTAATCCTGCCGTACCTGCCGTGTTCATTGGTGGGGAACTGGTCGGTGGTGCTAACGAAGTCATGAGTCTTCATCTTAAGCGAAACCTGATCCCAATGCTTAGGAAGGCCGGTGCTCTATGGGTTTAAACCTTCTTGCTCCCTAACTTGATGTAACTTTGACATAGCCAAGCTTTCCTATAATATATATATATAGGCAGAAATGGCACAGAGAGTTTACTTAAAAAAGTCTTTATGTAAAGTCCTTTTTTGGTGACTTCAAT ATGGAGACTGTCAACAAGTTGGTTTCTGATAGGCCGGTGGTAGTTTTCAGCAAGAATAGTTGCTGTATGAGCCACTCTATCAAGACACTCTTGTGTGATTTCGGAGTTAACCCGACGGTGTACGAGCTCGATGAGCTTCCCAGAGGGAAAGAGATAGAGCAAGCTCTTCTTCGGATTGGCTGTAATCCTGCCGTACCTGCCGTGTTCATTGGTGGGGAACTGGTCGGTGGTGCTAACGAAGTCATGAGTCTTCATCTTAAGCGAAACCTGATCCCAATGCTTAGGAAGGCCGGTGCTCTATGGGTTTAA ATGGAGACTGTCAACAAGTTGGTTTCTGATAGGCCGGTGGTAGTTTTCAGCAAGAATAGTTGCTGTATGAGCCACTCTATCAAGACACTCTTGTGTGATTTCGGAGTTAACCCGACGGTGTACGAGCTCGATGAGCTTCCCAGAGGGAAAGAGATAGAGCAAGCTCTTCTTCGGATTGGCTGTAATCCTGCCGTACCTGCCGTGTTCATTGGTGGGGAACTGGTCGGTGGTGCTAACGAAGTCATGAGTCTTCATCTTAAGCGAAACCTGATCCCAATGCTTAGGAAGGCCGGTGCTCTATGGGTTTAA
BLAST of CSPI06G14890 vs. Swiss-Prot
Match: GRXS2_ARATH (Monothiol glutaredoxin-S2 OS=Arabidopsis thaliana GN=GRXS2 PE=3 SV=1) HSP 1 Score: 176.0 bits (445), Expect = 2.1e-43 Identity = 78/102 (76.47%), Postives = 93/102 (91.18%), Query Frame = 1
BLAST of CSPI06G14890 vs. Swiss-Prot
Match: GRXS4_ARATH (Monothiol glutaredoxin-S4 OS=Arabidopsis thaliana GN=GRXS4 PE=3 SV=1) HSP 1 Score: 166.4 bits (420), Expect = 1.7e-40 Identity = 71/102 (69.61%), Postives = 91/102 (89.22%), Query Frame = 1
BLAST of CSPI06G14890 vs. Swiss-Prot
Match: GRXS3_ARATH (Monothiol glutaredoxin-S3 OS=Arabidopsis thaliana GN=GRXS3 PE=3 SV=1) HSP 1 Score: 165.6 bits (418), Expect = 2.8e-40 Identity = 71/102 (69.61%), Postives = 90/102 (88.24%), Query Frame = 1
BLAST of CSPI06G14890 vs. Swiss-Prot
Match: GRXS5_ARATH (Monothiol glutaredoxin-S5 OS=Arabidopsis thaliana GN=GRXS5 PE=3 SV=1) HSP 1 Score: 165.2 bits (417), Expect = 3.7e-40 Identity = 71/102 (69.61%), Postives = 91/102 (89.22%), Query Frame = 1
BLAST of CSPI06G14890 vs. Swiss-Prot
Match: GRXS7_ARATH (Monothiol glutaredoxin-S7 OS=Arabidopsis thaliana GN=GRXS7 PE=3 SV=2) HSP 1 Score: 163.3 bits (412), Expect = 1.4e-39 Identity = 71/102 (69.61%), Postives = 89/102 (87.25%), Query Frame = 1
BLAST of CSPI06G14890 vs. TrEMBL
Match: U3RJA0_CUCSA (Glutaredoxin OS=Cucumis sativus GN=GRX3 PE=2 SV=1) HSP 1 Score: 212.6 bits (540), Expect = 2.2e-52 Identity = 102/102 (100.00%), Postives = 102/102 (100.00%), Query Frame = 1
BLAST of CSPI06G14890 vs. TrEMBL
Match: A0A0S3R9B9_PHAAN (Uncharacterized protein OS=Vigna angularis var. angularis GN=Vigan.01G525700 PE=4 SV=1) HSP 1 Score: 181.8 bits (460), Expect = 4.2e-43 Identity = 81/102 (79.41%), Postives = 97/102 (95.10%), Query Frame = 1
BLAST of CSPI06G14890 vs. TrEMBL
Match: I1MRF6_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_17G023900 PE=4 SV=1) HSP 1 Score: 181.8 bits (460), Expect = 4.2e-43 Identity = 82/102 (80.39%), Postives = 96/102 (94.12%), Query Frame = 1
BLAST of CSPI06G14890 vs. TrEMBL
Match: A0A0B2P756_GLYSO (Monothiol glutaredoxin-S2 OS=Glycine soja GN=glysoja_004410 PE=4 SV=1) HSP 1 Score: 181.8 bits (460), Expect = 4.2e-43 Identity = 82/102 (80.39%), Postives = 96/102 (94.12%), Query Frame = 1
BLAST of CSPI06G14890 vs. TrEMBL
Match: A0A0L9TSM9_PHAAN (Uncharacterized protein OS=Phaseolus angularis GN=LR48_Vigan01g309600 PE=4 SV=1) HSP 1 Score: 181.8 bits (460), Expect = 4.2e-43 Identity = 81/102 (79.41%), Postives = 97/102 (95.10%), Query Frame = 1
BLAST of CSPI06G14890 vs. TAIR10
Match: AT5G18600.1 (AT5G18600.1 Thioredoxin superfamily protein) HSP 1 Score: 176.0 bits (445), Expect = 1.2e-44 Identity = 78/102 (76.47%), Postives = 93/102 (91.18%), Query Frame = 1
BLAST of CSPI06G14890 vs. TAIR10
Match: AT4G15680.1 (AT4G15680.1 Thioredoxin superfamily protein) HSP 1 Score: 166.4 bits (420), Expect = 9.3e-42 Identity = 71/102 (69.61%), Postives = 91/102 (89.22%), Query Frame = 1
BLAST of CSPI06G14890 vs. TAIR10
Match: AT4G15700.1 (AT4G15700.1 Thioredoxin superfamily protein) HSP 1 Score: 165.6 bits (418), Expect = 1.6e-41 Identity = 71/102 (69.61%), Postives = 90/102 (88.24%), Query Frame = 1
BLAST of CSPI06G14890 vs. TAIR10
Match: AT4G15690.1 (AT4G15690.1 Thioredoxin superfamily protein) HSP 1 Score: 165.2 bits (417), Expect = 2.1e-41 Identity = 71/102 (69.61%), Postives = 91/102 (89.22%), Query Frame = 1
BLAST of CSPI06G14890 vs. TAIR10
Match: AT4G15670.1 (AT4G15670.1 Thioredoxin superfamily protein) HSP 1 Score: 163.3 bits (412), Expect = 7.9e-41 Identity = 71/102 (69.61%), Postives = 89/102 (87.25%), Query Frame = 1
BLAST of CSPI06G14890 vs. NCBI nr
Match: gi|566006172|ref|NP_001274383.1| (monothiol glutaredoxin-S2-like [Cucumis sativus]) HSP 1 Score: 212.6 bits (540), Expect = 3.2e-52 Identity = 102/102 (100.00%), Postives = 102/102 (100.00%), Query Frame = 1
BLAST of CSPI06G14890 vs. NCBI nr
Match: gi|657996709|ref|XP_008390722.1| (PREDICTED: monothiol glutaredoxin-S2 [Malus domestica]) HSP 1 Score: 184.9 bits (468), Expect = 7.2e-44 Identity = 84/102 (82.35%), Postives = 94/102 (92.16%), Query Frame = 1
BLAST of CSPI06G14890 vs. NCBI nr
Match: gi|951003839|ref|XP_014507713.1| (PREDICTED: monothiol glutaredoxin-S2-like [Vigna radiata var. radiata]) HSP 1 Score: 184.1 bits (466), Expect = 1.2e-43 Identity = 83/102 (81.37%), Postives = 97/102 (95.10%), Query Frame = 1
BLAST of CSPI06G14890 vs. NCBI nr
Match: gi|694322177|ref|XP_009352227.1| (PREDICTED: monothiol glutaredoxin-S2 [Pyrus x bretschneideri]) HSP 1 Score: 182.2 bits (461), Expect = 4.7e-43 Identity = 83/102 (81.37%), Postives = 93/102 (91.18%), Query Frame = 1
BLAST of CSPI06G14890 vs. NCBI nr
Match: gi|920689557|gb|KOM33540.1| (hypothetical protein LR48_Vigan01g309600 [Vigna angularis]) HSP 1 Score: 181.8 bits (460), Expect = 6.1e-43 Identity = 81/102 (79.41%), Postives = 97/102 (95.10%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene: The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene:
|