CSPI05G02430 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.GCTATACTGTTAACAGCCAATTGCAACCCCCGATGGCTTACAAACCATGTGCCAACCTTGGCCATGTCTAGGAAGGTACCATTGATACTCGTGAAAGATAAAGAAGGATCATTAAGGTTAGGTGAACTCGTTAGCCTTAAAACAGCAATTGCAATTGGAATAAAGGTGAGTAGGAAGTATTAGATTTTTTATGTGATGTGTTCTGTTCTAACTTTTTCCTTTTTCTAACAAAGCTGCATGTTTCCAAACGAACTGCAGGCGAATGGGAGCCCTATTAATCAACTCATTGATGAAATCCTTCAAAGAACAACA GCTATACTGTTAACAGCCAATTGCAACCCCCGATGGCTTACAAACCATGTGCCAACCTTGGCCATGTCTAGGAAGGTACCATTGATACTCGTGAAAGATAAAGAAGGATCATTAAGGTTAGGTGAACTCGTTAGCCTTAAAACAGCAATTGCAATTGGAATAAAGGCGAATGGGAGCCCTATTAATCAACTCATTGATGAAATCCTTCAAAGAACAACA GCTATACTGTTAACAGCCAATTGCAACCCCCGATGGCTTACAAACCATGTGCCAACCTTGGCCATGTCTAGGAAGGTACCATTGATACTCGTGAAAGATAAAGAAGGATCATTAAGGTTAGGTGAACTCGTTAGCCTTAAAACAGCAATTGCAATTGGAATAAAGGCGAATGGGAGCCCTATTAATCAACTCATTGATGAAATCCTTCAAAGAACAACA
BLAST of CSPI05G02430 vs. TrEMBL
Match: A0A0A0KLN6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G126730 PE=4 SV=1) HSP 1 Score: 144.8 bits (364), Expect = 4.1e-32 Identity = 73/73 (100.00%), Postives = 73/73 (100.00%), Query Frame = 1
BLAST of CSPI05G02430 vs. TrEMBL
Match: A0A061DZK2_THECC (Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein, putative OS=Theobroma cacao GN=TCM_004947 PE=4 SV=1) HSP 1 Score: 108.6 bits (270), Expect = 3.2e-21 Identity = 55/70 (78.57%), Postives = 62/70 (88.57%), Query Frame = 1
BLAST of CSPI05G02430 vs. TrEMBL
Match: A0A0D2SBS2_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_007G117100 PE=4 SV=1) HSP 1 Score: 107.8 bits (268), Expect = 5.5e-21 Identity = 53/70 (75.71%), Postives = 63/70 (90.00%), Query Frame = 1
BLAST of CSPI05G02430 vs. TrEMBL
Match: A0A059DEG5_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_A01003 PE=4 SV=1) HSP 1 Score: 103.2 bits (256), Expect = 1.4e-19 Identity = 51/70 (72.86%), Postives = 62/70 (88.57%), Query Frame = 1
BLAST of CSPI05G02430 vs. TrEMBL
Match: M5XUD4_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa011899mg PE=4 SV=1) HSP 1 Score: 102.8 bits (255), Expect = 1.8e-19 Identity = 49/74 (66.22%), Postives = 64/74 (86.49%), Query Frame = 1
BLAST of CSPI05G02430 vs. TAIR10
Match: AT4G01790.1 (AT4G01790.1 Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein) HSP 1 Score: 85.5 bits (210), Expect = 1.5e-17 Identity = 42/71 (59.15%), Postives = 54/71 (76.06%), Query Frame = 1
BLAST of CSPI05G02430 vs. NCBI nr
Match: gi|778698540|ref|XP_011654557.1| (PREDICTED: uncharacterized protein LOC101221016 [Cucumis sativus]) HSP 1 Score: 144.8 bits (364), Expect = 5.8e-32 Identity = 73/73 (100.00%), Postives = 73/73 (100.00%), Query Frame = 1
BLAST of CSPI05G02430 vs. NCBI nr
Match: gi|700194607|gb|KGN49784.1| (hypothetical protein Csa_5G126730 [Cucumis sativus]) HSP 1 Score: 144.8 bits (364), Expect = 5.8e-32 Identity = 73/73 (100.00%), Postives = 73/73 (100.00%), Query Frame = 1
BLAST of CSPI05G02430 vs. NCBI nr
Match: gi|659072577|ref|XP_008466263.1| (PREDICTED: uncharacterized protein LOC103503720 isoform X2 [Cucumis melo]) HSP 1 Score: 137.9 bits (346), Expect = 7.1e-30 Identity = 68/72 (94.44%), Postives = 71/72 (98.61%), Query Frame = 1
BLAST of CSPI05G02430 vs. NCBI nr
Match: gi|659072579|ref|XP_008466271.1| (PREDICTED: uncharacterized protein LOC103503720 isoform X3 [Cucumis melo]) HSP 1 Score: 137.9 bits (346), Expect = 7.1e-30 Identity = 68/72 (94.44%), Postives = 71/72 (98.61%), Query Frame = 1
BLAST of CSPI05G02430 vs. NCBI nr
Match: gi|659072581|ref|XP_008466280.1| (PREDICTED: ribonuclease P protein subunit p38 isoform X4 [Cucumis melo]) HSP 1 Score: 137.9 bits (346), Expect = 7.1e-30 Identity = 68/72 (94.44%), Postives = 71/72 (98.61%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|