WMU48151 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
ACGCTCCTGGTTGCTGTACTCTTCCTCTCCCCCAGATATCTTCTTTGCAGGAGCGATCCGGGAGTCAATTTTGCTATCATGTTGGTTTACACCGACCTTCTCTCTGGTGATGAGCTTCTCTCGGATTCGTTTCCATACAAGGAAATCGAGAATGGAATGATTTTGGGAAGTCGATGGAAAGTGGGTCGTTCAAGGAGCGATTGATGTGGATATTGGTGCTAATCCTTCTGCTGAAGGTGCCGGTGAGGACGAGGGTGTTGATGATCAGGAAGTGCTGTAAGAGAGAGGATTATTCGGGCATTTCTAGTAGAAGAGCAGAAGATTGTGGCCTTGATCTTGCAGTTAACTACAATTCCCAGAATGTCCAGGTTATGACATTTGGACAACCTCGTATTGGCAATGCAGTATTTGCATCTTACTATAGCAATATAGTGCCAAATTCGTTTCGGGTTACGAATGGAAAATGATGTCCGTCCCCCATTTGCCTCCATTTTATGCTTATTTTCCTAAAAAAACATATCACCATTTTCCTAGAGAGGTATGTCTCTTTGATATCAAACAATGTCTCAATTTCAACTGTTAAATGGGGGTTGTTAAAGTAA
BLAST of WMU48151 vs. TAIR10
Match: AT5G18630.1 (AT5G18630.1 alpha/beta-Hydrolases superfamily protein) HSP 1 Score: 76.6 bits (187), Expect = 1.9e-14 Identity = 34/50 (68.00%), Postives = 39/50 (78.00%), Query Frame = 3
HSP 2 Score: 49.7 bits (117), Expect = 2.5e-06 Identity = 19/27 (70.37%), Postives = 21/27 (77.78%), Query Frame = 2
BLAST of WMU48151 vs. TAIR10
Match: AT5G18640.1 (AT5G18640.1 alpha/beta-Hydrolases superfamily protein) HSP 1 Score: 69.3 bits (168), Expect = 3.0e-12 Identity = 30/50 (60.00%), Postives = 37/50 (74.00%), Query Frame = 3
HSP 2 Score: 49.3 bits (116), Expect = 3.2e-06 Identity = 19/28 (67.86%), Postives = 21/28 (75.00%), Query Frame = 2
BLAST of WMU48151 vs. TAIR10
Match: AT3G05540.1 (AT3G05540.1 Methionine sulfoxide reductase (MSS4-like) family protein) HSP 1 Score: 63.2 bits (152), Expect = 2.2e-10 Identity = 29/37 (78.38%), Postives = 30/37 (81.08%), Query Frame = 2
HSP 2 Score: 30.0 bits (66), Expect = 2.0e+00 Identity = 16/35 (45.71%), Postives = 16/35 (45.71%), Query Frame = 1
BLAST of WMU48151 vs. TAIR10
Match: AT3G16640.1 (AT3G16640.1 translationally controlled tumor protein) HSP 1 Score: 63.2 bits (152), Expect = 2.2e-10 Identity = 27/34 (79.41%), Postives = 28/34 (82.35%), Query Frame = 2
BLAST of WMU48151 vs. Swiss-Prot
Match: TCTP_ORYSJ (Translationally-controlled tumor protein homolog OS=Oryza sativa subsp. japonica GN=TCTP PE=1 SV=1) HSP 1 Score: 76.3 bits (186), Expect = 4.4e-13 Identity = 34/37 (91.89%), Postives = 33/37 (89.19%), Query Frame = 2
BLAST of WMU48151 vs. Swiss-Prot
Match: TCTP_CUCMA (Translationally-controlled tumor protein homolog OS=Cucurbita maxima GN=TCTP PE=2 SV=1) HSP 1 Score: 74.7 bits (182), Expect = 1.3e-12 Identity = 33/37 (89.19%), Postives = 33/37 (89.19%), Query Frame = 2
HSP 2 Score: 30.0 bits (66), Expect = 3.6e+01 Identity = 16/35 (45.71%), Postives = 16/35 (45.71%), Query Frame = 1
BLAST of WMU48151 vs. Swiss-Prot
Match: TCTP_HORVU (Translationally-controlled tumor protein homolog OS=Hordeum vulgare GN=TCTP PE=2 SV=2) HSP 1 Score: 74.7 bits (182), Expect = 1.3e-12 Identity = 33/37 (89.19%), Postives = 32/37 (86.49%), Query Frame = 2
BLAST of WMU48151 vs. Swiss-Prot
Match: TCTP_HEVBR (Translationally-controlled tumor protein homolog OS=Hevea brasiliensis GN=TCTP PE=2 SV=1) HSP 1 Score: 74.3 bits (181), Expect = 1.7e-12 Identity = 33/37 (89.19%), Postives = 33/37 (89.19%), Query Frame = 2
BLAST of WMU48151 vs. Swiss-Prot
Match: TCTP_CUCME (Translationally-controlled tumor protein homolog OS=Cucumis melo GN=TCTP PE=2 SV=1) HSP 1 Score: 73.9 bits (180), Expect = 2.2e-12 Identity = 32/37 (86.49%), Postives = 33/37 (89.19%), Query Frame = 2
HSP 2 Score: 30.8 bits (68), Expect = 2.1e+01 Identity = 17/35 (48.57%), Postives = 16/35 (45.71%), Query Frame = 1
BLAST of WMU48151 vs. NCBI nr
Match: gi|449432813|ref|XP_004134193.1| (PREDICTED: lipase [Cucumis sativus]) HSP 1 Score: 96.3 bits (238), Expect = 6.5e-17 Identity = 44/46 (95.65%), Postives = 45/46 (97.83%), Query Frame = 3
BLAST of WMU48151 vs. NCBI nr
Match: gi|659076691|ref|XP_008438817.1| (PREDICTED: lipase-like [Cucumis melo]) HSP 1 Score: 96.3 bits (238), Expect = 6.5e-17 Identity = 44/46 (95.65%), Postives = 45/46 (97.83%), Query Frame = 3
BLAST of WMU48151 vs. NCBI nr
Match: gi|629076814|gb|KCW44781.1| (hypothetical protein EUGRSUZ_L01655 [Eucalyptus grandis]) HSP 1 Score: 83.6 bits (205), Expect = 4.4e-13 Identity = 38/46 (82.61%), Postives = 42/46 (91.30%), Query Frame = 3
BLAST of WMU48151 vs. NCBI nr
Match: gi|702511921|ref|XP_010040920.1| (PREDICTED: lipase-like [Eucalyptus grandis]) HSP 1 Score: 83.6 bits (205), Expect = 4.4e-13 Identity = 38/46 (82.61%), Postives = 42/46 (91.30%), Query Frame = 3
BLAST of WMU48151 vs. NCBI nr
Match: gi|702262575|ref|XP_010036894.1| (PREDICTED: lipase-like [Eucalyptus grandis]) HSP 1 Score: 83.6 bits (205), Expect = 4.4e-13 Identity = 38/46 (82.61%), Postives = 42/46 (91.30%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|