MU44193 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
AACCCGCCATTTTTTCCACCACTTGCACTTTTAGGGCTCACATTCACCGTCTGCGAACACCCAATTTTTGCTTTCGTCTTTCACCTTCCGCCGGACGATCCACTTCCGTTACCTTCTTCTTCACCTCACTCCGCATTTCCTCATAGTCTCTGAGTTTGATCACAAGGTACAACTTTCGCTCTTCTTGTTTCCATTTATCCCTCCTCCAACTCGCAAGAATTTCAAAATGGCGATGGGCATCGATCCTAGGCATCCGTGTGAAGTATCGAGGAAGAAAACATGCGAGAAGATCAAGGCAATTCAGGCGACGGTCTCAAATTTGGCGGTAAATGTTCTCAAATGAATTGGTTGGAACACTCAAAAGCACATAAAGATTTCTCATGCCAAAAGAAGTTTCTATGCTCGAATTTTCTCTTCTCTTTACCAGAATAAAAGCCTTCTACTACACAGGAGCAACTGACACTGGGAATTTGGCCTGTCAGATGCAGAATCTTCAAAGAATACAAAGCTCACAGATTGAAAAGGCTAATAACAAAAAAGTGTTCGGTATTCACTCCTTTCGTCCAAATCAAAGAGAGGTCATTAATGCTACAATGAGTGGGTATGATGTCTTTGTTTTAATGCCAACTGGAGGGGGAAAGAGCCTAACCTACCAGCTCTTTGTGCCTGCTATCATACAAGTTTTTCCAGTGCTATGAATATTTCCTCATTGATTGTCAGGTATTTGGCAATTTTGTTACATGGTTGAAATTATTACTTATTATTTTGGTTTCTCTGCACCTCCCTGCTTTGATATCTCCACTTGTGTCTCTTATTCAAGATCAGATCATGCATTTAATATAGGCAAACATTTTGGCTGCTTACCTAAGTGCCAATATGGAGTGGGGTCAACAACAAGAAATTTTTAGAGACTTGAGTTCTGATTGCACTAAATACAAGCTTCTGTATGTCATGCCAGAAAAAGTTGCTAAGTAAGTTTTACCTGTTGTTCTCTTAGCGCAATAACTTAATTCGTTATTTTTACCTTCTGTAACATGATCTTTGCTCGTGAATTACGTCAATGTGATATAAGCCAGGCATAATAAACTACTTGGTTATTTTAAACTG
BLAST of MU44193 vs. Swiss-Prot
Match: RQL4A_ARATH (ATP-dependent DNA helicase Q-like 4A OS=Arabidopsis thaliana GN=RECQL4A PE=2 SV=1) HSP 1 Score: 89.0 bits (219), Expect = 1.2e-16 Identity = 44/52 (84.62%), Postives = 45/52 (86.54%), Query Frame = 3
HSP 2 Score: 77.0 bits (188), Expect = 4.7e-13 Identity = 39/56 (69.64%), Postives = 46/56 (82.14%), Query Frame = 1
HSP 3 Score: 35.4 bits (80), Expect = 1.6e+00 Identity = 17/34 (50.00%), Postives = 19/34 (55.88%), Query Frame = 1
BLAST of MU44193 vs. Swiss-Prot
Match: RQL4B_ARATH (ATP-dependent DNA helicase Q-like 4B OS=Arabidopsis thaliana GN=RECQL4B PE=2 SV=1) HSP 1 Score: 82.8 bits (203), Expect = 8.6e-15 Identity = 41/49 (83.67%), Postives = 42/49 (85.71%), Query Frame = 3
HSP 2 Score: 76.3 bits (186), Expect = 8.1e-13 Identity = 39/56 (69.64%), Postives = 44/56 (78.57%), Query Frame = 1
BLAST of MU44193 vs. Swiss-Prot
Match: BLM_DROME (Bloom syndrome protein homolog OS=Drosophila melanogaster GN=Blm PE=1 SV=1) HSP 1 Score: 65.9 bits (159), Expect = 1.1e-09 Identity = 33/45 (73.33%), Postives = 35/45 (77.78%), Query Frame = 3
HSP 2 Score: 43.5 bits (101), Expect = 5.8e-03 Identity = 27/56 (48.21%), Postives = 28/56 (50.00%), Query Frame = 1
BLAST of MU44193 vs. Swiss-Prot
Match: SGS1_YEAST (ATP-dependent helicase SGS1 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=SGS1 PE=1 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 1.9e-09 Identity = 31/48 (64.58%), Postives = 36/48 (75.00%), Query Frame = 3
HSP 2 Score: 36.6 bits (83), Expect = 7.1e-01 Identity = 21/56 (37.50%), Postives = 31/56 (55.36%), Query Frame = 1
BLAST of MU44193 vs. Swiss-Prot
Match: BLM_HUMAN (Bloom syndrome protein OS=Homo sapiens GN=BLM PE=1 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 5.4e-09 Identity = 32/60 (53.33%), Postives = 40/60 (66.67%), Query Frame = 3
BLAST of MU44193 vs. TrEMBL
Match: A0A0A0L762_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G221760 PE=4 SV=1) HSP 1 Score: 101.3 bits (251), Expect = 2.6e-18 Identity = 50/56 (89.29%), Postives = 52/56 (92.86%), Query Frame = 1
BLAST of MU44193 vs. TrEMBL
Match: A0A0A0L762_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G221760 PE=4 SV=1) HSP 1 Score: 94.4 bits (233), Expect = 3.2e-16 Identity = 47/52 (90.38%), Postives = 49/52 (94.23%), Query Frame = 3
HSP 2 Score: 76.6 bits (187), Expect = 6.9e-11 Identity = 34/36 (94.44%), Postives = 34/36 (94.44%), Query Frame = 1
HSP 3 Score: 53.9 bits (128), Expect = 4.8e-04 Identity = 25/29 (86.21%), Postives = 27/29 (93.10%), Query Frame = 3
HSP 4 Score: 95.1 bits (235), Expect = 1.9e-16 Identity = 45/50 (90.00%), Postives = 47/50 (94.00%), Query Frame = 3
BLAST of MU44193 vs. TrEMBL
Match: W9RMQ1_9ROSA (ATP-dependent DNA helicase Q-like 4A OS=Morus notabilis GN=L484_016719 PE=4 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 2.7e-07 Identity = 31/39 (79.49%), Postives = 34/39 (87.18%), Query Frame = 1
HSP 2 Score: 94.7 bits (234), Expect = 2.4e-16 Identity = 50/62 (80.65%), Postives = 52/62 (83.87%), Query Frame = 3
BLAST of MU44193 vs. TrEMBL
Match: F6HK69_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_12s0035g00400 PE=4 SV=1) HSP 1 Score: 81.3 bits (199), Expect = 2.8e-12 Identity = 43/56 (76.79%), Postives = 47/56 (83.93%), Query Frame = 1
HSP 2 Score: 94.4 bits (233), Expect = 3.2e-16 Identity = 47/52 (90.38%), Postives = 49/52 (94.23%), Query Frame = 3
BLAST of MU44193 vs. TrEMBL
Match: A0A0B0NH64_GOSAR (ATP-dependent DNA helicase Q-like 4A OS=Gossypium arboreum GN=F383_17286 PE=4 SV=1) HSP 1 Score: 89.0 bits (219), Expect = 1.3e-14 Identity = 44/56 (78.57%), Postives = 49/56 (87.50%), Query Frame = 1
HSP 2 Score: 94.4 bits (233), Expect = 3.2e-16 Identity = 47/52 (90.38%), Postives = 49/52 (94.23%), Query Frame = 3
BLAST of MU44193 vs. TAIR10
Match: AT1G10930.1 (AT1G10930.1 DNA helicase (RECQl4A)) HSP 1 Score: 89.0 bits (219), Expect = 6.8e-18 Identity = 44/52 (84.62%), Postives = 45/52 (86.54%), Query Frame = 3
HSP 2 Score: 77.0 bits (188), Expect = 2.7e-14 Identity = 39/56 (69.64%), Postives = 46/56 (82.14%), Query Frame = 1
HSP 3 Score: 35.4 bits (80), Expect = 8.9e-02 Identity = 17/34 (50.00%), Postives = 19/34 (55.88%), Query Frame = 1
BLAST of MU44193 vs. TAIR10
Match: AT1G60930.1 (AT1G60930.1 RECQ helicase L4B) HSP 1 Score: 82.8 bits (203), Expect = 4.8e-16 Identity = 41/49 (83.67%), Postives = 42/49 (85.71%), Query Frame = 3
HSP 2 Score: 76.3 bits (186), Expect = 4.5e-14 Identity = 39/56 (69.64%), Postives = 44/56 (78.57%), Query Frame = 1
BLAST of MU44193 vs. TAIR10
Match: AT1G31360.1 (AT1G31360.1 RECQ helicase L2) HSP 1 Score: 58.2 bits (139), Expect = 1.3e-08 Identity = 30/56 (53.57%), Postives = 37/56 (66.07%), Query Frame = 3
HSP 2 Score: 38.1 bits (87), Expect = 1.4e-02 Identity = 21/56 (37.50%), Postives = 30/56 (53.57%), Query Frame = 1
BLAST of MU44193 vs. TAIR10
Match: AT4G35740.1 (AT4G35740.1 DEAD/DEAH box RNA helicase family protein ) HSP 1 Score: 52.0 bits (123), Expect = 9.2e-07 Identity = 33/79 (41.77%), Postives = 41/79 (51.90%), Query Frame = 3
HSP 2 Score: 42.0 bits (97), Expect = 9.5e-04 Identity = 22/56 (39.29%), Postives = 31/56 (55.36%), Query Frame = 1
BLAST of MU44193 vs. TAIR10
Match: AT3G05740.1 (AT3G05740.1 RECQ helicase l1) HSP 1 Score: 51.6 bits (122), Expect = 1.2e-06 Identity = 29/59 (49.15%), Postives = 33/59 (55.93%), Query Frame = 3
HSP 2 Score: 40.8 bits (94), Expect = 2.1e-03 Identity = 25/57 (43.86%), Postives = 32/57 (56.14%), Query Frame = 1
BLAST of MU44193 vs. NCBI nr
Match: gi|659112092|ref|XP_008456062.1| (PREDICTED: ATP-dependent DNA helicase Q-like 4A isoform X5 [Cucumis melo]) HSP 1 Score: 143.7 bits (361), Expect = 6.6e-31 Identity = 72/77 (93.51%), Postives = 73/77 (94.81%), Query Frame = 3
BLAST of MU44193 vs. NCBI nr
Match: gi|659112086|ref|XP_008456059.1| (PREDICTED: ATP-dependent DNA helicase Q-like 4A isoform X2 [Cucumis melo]) HSP 1 Score: 115.2 bits (287), Expect = 2.5e-22 Identity = 52/56 (92.86%), Postives = 53/56 (94.64%), Query Frame = 1
BLAST of MU44193 vs. NCBI nr
Match: gi|659112082|ref|XP_008456057.1| (PREDICTED: ATP-dependent DNA helicase Q-like 4A isoform X1 [Cucumis melo]) HSP 1 Score: 115.2 bits (287), Expect = 2.5e-22 Identity = 52/56 (92.86%), Postives = 53/56 (94.64%), Query Frame = 1
BLAST of MU44193 vs. NCBI nr
Match: gi|778680266|ref|XP_011651280.1| (PREDICTED: ATP-dependent DNA helicase Q-like 4A isoform X1 [Cucumis sativus]) HSP 1 Score: 112.8 bits (281), Expect = 1.2e-21 Identity = 51/56 (91.07%), Postives = 52/56 (92.86%), Query Frame = 1
BLAST of MU44193 vs. NCBI nr
Match: gi|659112090|ref|XP_008456061.1| (PREDICTED: ATP-dependent DNA helicase Q-like 4A isoform X4 [Cucumis melo]) HSP 1 Score: 104.0 bits (258), Expect = 5.8e-19 Identity = 51/56 (91.07%), Postives = 52/56 (92.86%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of melon unigene v4
Date Performed: 2016-11-16
|