MELO3C017010 (gene) Melon (DHL92) v3.5.1 | Cucurbit Genomics Database (CuGenDB)

Overview


Name	MELO3C017010
Type	gene
Organism	Cucumis melo (Melon (DHL92) v3.5.1)
Description	NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 2, mitochondrial
Location	chr7 : 447049 .. 449197 (-)

Genome Viewer

Gene Expression

Sequences

The following sequences are available for this feature:

Gene sequence (with intron)

Legend: CDS

Hold the cursor over a type above to highlight its positions in the sequence below.

AAGCTTCCATCTTCTTCATTCGATCCTTTCTGCAGTCGGATTTTGGTGATCAATTGAAAGTGTAGAGGGCAATTATGGGAGGCGGTGGACATGGAGCTGGAACTACTTACAAGGGCGTGACCATACACCCACCAAAGCGATGGCACACCGTCACCGGCAAGGGGCTGTGCGCCATTATGTGGTATAAACCCTAGCTTCATTAGTTTCCGATCGAGCAATTCTATTGAAGGAACCTAATTTTGATTTTCCTGTTTCAGCCAAATTGCCTCATAGTTAATTTCTTTACTTTCTTTTTCTGTTTTACAAATCCTGCGTCTATTCCGATCTGTCCTCGTCGCATTATTCCAAATAAATGCATCGCGCTCGAGTGGAGTTACAAGTTTTAATAATATCTTGATGCCAGATGCTATATCCGAGTTCATCGTCTCGTATGCAATTTGATGTTGAGAATCAGTAGGATTGCTATTGAGAAATTGGCATCTGGGTATTGACCAAATTTTTTATGACTATCTTTCAGGTTTTGGGTGCTATACAGGGCGAAACAAGATGGACCTGTAGTACTGGTAAAAATCACTGTTTCCTTAATCGTAAATTATATTTCTACTTATTATTGGTTAAAATCTCTAAATTTTCTGGCTGAAGTTCTTGAGGATATATATGTTATAGGGCAATCTTTGGAGCGATTTAAAATCATTTGTTGTTTTTAAATTTAGTAGAAAAATGTTGCAATCATTCAAAATCCATTATATTTCTAATAGTATGGAAAATTCAATTAGAAGTGTAAAATTAAACATTAAATTGATTTTAAGTGATTAAAGCCTAACCTTGTGTTTGGAAGTTATTTTAAATATGACAAAAAGTGACGTTAACCATTTTCAAAACATTTTGTTGCCATTTTTAGCTTACACAGTATGTATTTTCTATTCCAGAAAATCTAACTTTTGTAATATTTGTTACGATCAGGGCTGGAGACATCCATGGGAAGGCCATGGTCATGGTGACCATGGTGACCATGGGCATGGGCACTAGGTATTGTTTTTATTATTTACCTCTCTTTCCAAATTTCCCCAATTAATTATCTGTTTTTATAGAGAAAAAAAAGTCAAAACAAAGTGTGTCCTAGCATTCTGATATAATTACAACACTGAACTATTAGCTATTTGACATCAGGTAATATGAGCGCTATCAGCTAT

mRNA sequence

AAGCTTCCATCTTCTTCATTCGATCCTTTCTGCAGTCGGATTTTGGTGATCAATTGAAAGTGTAGAGGGCAATTATGGGAGGCGGTGGACATGGAGCTGGAACTACTTACAAGGGCGTGACCATACACCCACCAAAGCGATGGCACACCGTCACCGGCAAGGGGCTGTGCGCCATTATGTGGTTTTGGGTGCTATACAGGGCGAAACAAGATGGACCTGTAGTACTGGGCTGGAGACATCCATGGGAAGGCCATGGTCATGGTGACCATGGTGACCATGGGCATGGGCACTAGGTATTGTTTTTATTATTTACCTCTCTTTCCAAATTTCCCCAATTAATTATCTGTTTTTATAGAGAAAAAAAAGTCAAAACAAAGTGTGTCCTAGCATTCTGATATAATTACAACACTGAACTATTAGCTATTTGACATCAGGTAATATGAGCGCTATCAGCTAT

Coding sequence (CDS)

ATGGGAGGCGGTGGACATGGAGCTGGAACTACTTACAAGGGCGTGACCATACACCCACCAAAGCGATGGCACACCGTCACCGGCAAGGGGCTGTGCGCCATTATGTGGTTTTGGGTGCTATACAGGGCGAAACAAGATGGACCTGTAGTACTGGGCTGGAGACATCCATGGGAAGGCCATGGTCATGGTGACCATGGTGACCATGGGCATGGGCACTAG

Annotated Terms

The following terms have been associated with this gene:

Vocabulary: **INTERPRO**
Term	Definition
IPR026627	NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 2
IPR026627	NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 2

Vocabulary: **Cellular Component**
Term	Definition
GO:0005743	mitochondrial inner membrane
GO:0005747	mitochondrial respiratory chain complex I
GO:0005743	mitochondrial inner membrane
GO:0005747	mitochondrial respiratory chain complex I

GO Annotation

GO Assignments

This gene is annotated with the following GO terms.

Category	Term Accession	Term Name
biological_process	GO:0008150	biological_process
biological_process	GO:0055114	oxidation-reduction process
cellular_component	GO:0005747	mitochondrial respiratory chain complex I
cellular_component	GO:0005743	mitochondrial inner membrane
cellular_component	GO:0016021	integral component of membrane
cellular_component	GO:0005575	cellular_component
molecular_function	GO:0003674	molecular_function

Unigene

This gene is associated with the following unigenes:


Unigene Name	Analysis Name	Sequence type in Unigene
MU43160	melon EST collection version 4.0	transcribed_cluster
MU60993	melon EST collection version 4.0	transcribed_cluster
MU61009	melon EST collection version 4.0	transcribed_cluster
MU61063	melon EST collection version 4.0	transcribed_cluster
MU61069	melon EST collection version 4.0	transcribed_cluster
MU61678	melon EST collection version 4.0	transcribed_cluster

Relationships

The following mRNA feature(s) are a part of this gene:


Feature Name	Unique Name	Type
MELO3C017010T3	MELO3C017010T3	mRNA
MELO3C017010T5	MELO3C017010T5	mRNA
MELO3C017010T4	MELO3C017010T4	mRNA
MELO3C017010T2	MELO3C017010T2	mRNA
MELO3C017010T1	MELO3C017010T1	mRNA
MELO3C017010T6	MELO3C017010T6	mRNA

The following transcribed_cluster feature(s) are associated with this gene:


Feature Name	Unique Name	Type
MU61063	MU61063	transcribed_cluster
MU43160	MU43160	transcribed_cluster
MU60993	MU60993	transcribed_cluster
MU61009	MU61009	transcribed_cluster
MU61069	MU61069	transcribed_cluster
MU61678	MU61678	transcribed_cluster

Synteny

The following gene(s) are orthologous to this gene:


Gene	Orthologue	Organism	Block
MELO3C017010	Csa4G653460	Cucumber (Chinese Long) v2	cumeB313
MELO3C017010	Cla97C05G096300	Watermelon (97103) v2	mewmbB481
MELO3C017010	Bhi09G002416	Wax gourd	mewgoB595
MELO3C017010	CSPI04G26760	Wild cucumber (PI 183967)	cpimeB311
MELO3C017010	Cucsa.271980	Cucumber (Gy14) v1	cgymeB454
MELO3C017010	CmaCh09G000680	Cucurbita maxima (Rimu)	cmameB037
MELO3C017010	Cp4.1LG06g00290	Cucurbita pepo (Zucchini)	cpemeB731
MELO3C017010	CsGy4G025100	Cucumber (Gy14) v2	cgybmeB270
MELO3C017010	Carg08642	Silver-seed gourd	carmeB0107
MELO3C017010	CsaV3_4G037120	Cucumber (Chinese Long) v3	cucmeB316

The following gene(s) are paralogous to this gene:

None

The following block(s) are covering this gene:


Gene	Organism	Block
MELO3C017010	Cucurbita maxima (Rimu)	cmameB442
MELO3C017010	Cucurbita moschata (Rifu)	cmomeB026
MELO3C017010	Cucurbita moschata (Rifu)	cmomeB434
MELO3C017010	Watermelon (Charleston Gray)	mewcgB476
MELO3C017010	Watermelon (97103) v1	mewmB524
MELO3C017010	Cucurbita pepo (Zucchini)	cpemeB531
MELO3C017010	Bottle gourd (USVL1VR-Ls)	lsimeB323
MELO3C017010	Silver-seed gourd	carmeB0363