Lsi05G016020 (gene) Bottle gourd (USVL1VR-Ls)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCAACTCTTCATTTTGTTCCATCTGCTTTCTCTCTACCCAAACAAAAGCAACCCACCAAGCTTTCCTCAGTCTTCAAGCTCAGACCCACAACCCAGATAGCCTGCTCACGGCGGCGCTTGGTGGTCCGGTCGTACAAAGTGGTGATCGAGCACGAGGGGAAGGCCACCGAGCTTGAGGTCGATGCCGACGAGAGCATATTGAGCAGTGCATTGGACAATGGCATAGAAATTCCTCACGATTGCAAGCTTGGAGTGTGCATGACTTGCCCTGCTCGCCTTGTCAGTGGCACCGTCGACCAAAGCGAAGGCATGCTGAGCGATGACGTTGTGGAGCAAGGCTATTCGCTTCTGTGTGTGGCTTATCCCCGCTCAGACTGCCACATAAAAACCATCCCTGAGGAAGAATTGTTGGCACTTCAATTAGCCACGGCTAATGACTAA ATGGCAACTCTTCATTTTGTTCCATCTGCTTTCTCTCTACCCAAACAAAAGCAACCCACCAAGCTTTCCTCAGTCTTCAAGCTCAGACCCACAACCCAGATAGCCTGCTCACGGCGGCGCTTGGTGGTCCGGTCGTACAAAGTGGTGATCGAGCACGAGGGGAAGGCCACCGAGCTTGAGGTCGATGCCGACGAGAGCATATTGAGCAGTGCATTGGACAATGGCATAGAAATTCCTCACGATTGCAAGCTTGGAGTGTGCATGACTTGCCCTGCTCGCCTTGTCAGTGGCACCGTCGACCAAAGCGAAGGCATGCTGAGCGATGACGTTGTGGAGCAAGGCTATTCGCTTCTGTGTGTGGCTTATCCCCGCTCAGACTGCCACATAAAAACCATCCCTGAGGAAGAATTGTTGGCACTTCAATTAGCCACGGCTAATGACTAA ATGGCAACTCTTCATTTTGTTCCATCTGCTTTCTCTCTACCCAAACAAAAGCAACCCACCAAGCTTTCCTCAGTCTTCAAGCTCAGACCCACAACCCAGATAGCCTGCTCACGGCGGCGCTTGGTGGTCCGGTCGTACAAAGTGGTGATCGAGCACGAGGGGAAGGCCACCGAGCTTGAGGTCGATGCCGACGAGAGCATATTGAGCAGTGCATTGGACAATGGCATAGAAATTCCTCACGATTGCAAGCTTGGAGTGTGCATGACTTGCCCTGCTCGCCTTGTCAGTGGCACCGTCGACCAAAGCGAAGGCATGCTGAGCGATGACGTTGTGGAGCAAGGCTATTCGCTTCTGTGTGTGGCTTATCCCCGCTCAGACTGCCACATAAAAACCATCCCTGAGGAAGAATTGTTGGCACTTCAATTAGCCACGGCTAATGACTAA MATLHFVPSAFSLPKQKQPTKLSSVFKLRPTTQIACSRRRLVVRSYKVVIEHEGKATELEVDADESILSSALDNGIEIPHDCKLGVCMTCPARLVSGTVDQSEGMLSDDVVEQGYSLLCVAYPRSDCHIKTIPEEELLALQLATAND
BLAST of Lsi05G016020 vs. Swiss-Prot
Match: FER2_SYNP6 (Ferredoxin-2 OS=Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1) GN=petF2 PE=3 SV=2) HSP 1 Score: 98.2 bits (243), Expect = 7.9e-20 Identity = 46/98 (46.94%), Postives = 68/98 (69.39%), Query Frame = 1
BLAST of Lsi05G016020 vs. Swiss-Prot
Match: FER_MASLA (Ferredoxin OS=Mastigocladus laminosus GN=petF PE=1 SV=2) HSP 1 Score: 97.8 bits (242), Expect = 1.0e-19 Identity = 49/96 (51.04%), Postives = 64/96 (66.67%), Query Frame = 1
BLAST of Lsi05G016020 vs. Swiss-Prot
Match: FER1_DESMC (Ferredoxin-1 OS=Desmonostoc muscorum PE=1 SV=2) HSP 1 Score: 97.4 bits (241), Expect = 1.3e-19 Identity = 47/94 (50.00%), Postives = 64/94 (68.09%), Query Frame = 1
BLAST of Lsi05G016020 vs. Swiss-Prot
Match: FER1_LEPBY (Ferredoxin-1 OS=Leptolyngbya boryana GN=petF1 PE=1 SV=1) HSP 1 Score: 95.5 bits (236), Expect = 5.1e-19 Identity = 47/96 (48.96%), Postives = 63/96 (65.62%), Query Frame = 1
BLAST of Lsi05G016020 vs. Swiss-Prot
Match: FER_CHLFR (Ferredoxin OS=Chlorogloeopsis fritschii PE=1 SV=2) HSP 1 Score: 95.1 bits (235), Expect = 6.7e-19 Identity = 47/96 (48.96%), Postives = 63/96 (65.62%), Query Frame = 1
BLAST of Lsi05G016020 vs. TrEMBL
Match: A0A0A0L4U6_CUCSA (Ferredoxin-1 OS=Cucumis sativus GN=Csa_3G146700 PE=4 SV=1) HSP 1 Score: 271.6 bits (693), Expect = 5.8e-70 Identity = 137/147 (93.20%), Postives = 140/147 (95.24%), Query Frame = 1
BLAST of Lsi05G016020 vs. TrEMBL
Match: F6HDQ5_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_05s0020g03490 PE=4 SV=1) HSP 1 Score: 213.8 bits (543), Expect = 1.4e-52 Identity = 108/148 (72.97%), Postives = 125/148 (84.46%), Query Frame = 1
BLAST of Lsi05G016020 vs. TrEMBL
Match: W9R8L4_9ROSA (Ferredoxin-3 OS=Morus notabilis GN=L484_004463 PE=4 SV=1) HSP 1 Score: 211.1 bits (536), Expect = 9.3e-52 Identity = 105/148 (70.95%), Postives = 125/148 (84.46%), Query Frame = 1
BLAST of Lsi05G016020 vs. TrEMBL
Match: M5XRP8_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa012963mg PE=4 SV=1) HSP 1 Score: 209.1 bits (531), Expect = 3.5e-51 Identity = 105/150 (70.00%), Postives = 127/150 (84.67%), Query Frame = 1
BLAST of Lsi05G016020 vs. TrEMBL
Match: V4RGX0_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10006141mg PE=4 SV=1) HSP 1 Score: 205.3 bits (521), Expect = 5.1e-50 Identity = 105/152 (69.08%), Postives = 123/152 (80.92%), Query Frame = 1
BLAST of Lsi05G016020 vs. TAIR10
Match: AT4G14890.1 (AT4G14890.1 2Fe-2S ferredoxin-like superfamily protein) HSP 1 Score: 183.3 bits (464), Expect = 1.1e-46 Identity = 92/146 (63.01%), Postives = 111/146 (76.03%), Query Frame = 1
BLAST of Lsi05G016020 vs. TAIR10
Match: AT2G27510.1 (AT2G27510.1 ferredoxin 3) HSP 1 Score: 91.7 bits (226), Expect = 4.2e-19 Identity = 45/94 (47.87%), Postives = 63/94 (67.02%), Query Frame = 1
BLAST of Lsi05G016020 vs. TAIR10
Match: AT1G10960.1 (AT1G10960.1 ferredoxin 1) HSP 1 Score: 79.3 bits (194), Expect = 2.1e-15 Identity = 50/142 (35.21%), Postives = 81/142 (57.04%), Query Frame = 1
BLAST of Lsi05G016020 vs. TAIR10
Match: AT5G10000.1 (AT5G10000.1 ferredoxin 4) HSP 1 Score: 79.0 bits (193), Expect = 2.8e-15 Identity = 47/128 (36.72%), Postives = 70/128 (54.69%), Query Frame = 1
BLAST of Lsi05G016020 vs. TAIR10
Match: AT1G60950.1 (AT1G60950.1 2Fe-2S ferredoxin-like superfamily protein) HSP 1 Score: 78.6 bits (192), Expect = 3.6e-15 Identity = 46/117 (39.32%), Postives = 72/117 (61.54%), Query Frame = 1
BLAST of Lsi05G016020 vs. NCBI nr
Match: gi|449432700|ref|XP_004134137.1| (PREDICTED: ferredoxin-1 [Cucumis sativus]) HSP 1 Score: 271.6 bits (693), Expect = 8.3e-70 Identity = 137/147 (93.20%), Postives = 140/147 (95.24%), Query Frame = 1
BLAST of Lsi05G016020 vs. NCBI nr
Match: gi|659076437|ref|XP_008438679.1| (PREDICTED: ferredoxin, root R-B2 [Cucumis melo]) HSP 1 Score: 270.8 bits (691), Expect = 1.4e-69 Identity = 136/147 (92.52%), Postives = 140/147 (95.24%), Query Frame = 1
BLAST of Lsi05G016020 vs. NCBI nr
Match: gi|225432672|ref|XP_002282517.1| (PREDICTED: ferredoxin, root R-B2 [Vitis vinifera]) HSP 1 Score: 213.8 bits (543), Expect = 2.1e-52 Identity = 108/148 (72.97%), Postives = 125/148 (84.46%), Query Frame = 1
BLAST of Lsi05G016020 vs. NCBI nr
Match: gi|297737056|emb|CBI26257.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 213.8 bits (543), Expect = 2.1e-52 Identity = 108/148 (72.97%), Postives = 125/148 (84.46%), Query Frame = 1
BLAST of Lsi05G016020 vs. NCBI nr
Match: gi|703078552|ref|XP_010090921.1| (Ferredoxin-3 [Morus notabilis]) HSP 1 Score: 211.1 bits (536), Expect = 1.3e-51 Identity = 105/148 (70.95%), Postives = 125/148 (84.46%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Lagenaria siceraria
Date Performed: 2017-09-18
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|