CmoCh13G000480 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCCAAGCATCATCCCGATTTGATTATGTGCAGAAAGCAGCCAGGAATCGCCATTGGCCGACTTTGTGAGAAGTGCGACGGGAAGTGTGTAATATGTGATTCTTATGTCCGTCCCTGTACTCTCGTTCGGGTTTGTGATGAATGCAATTACGGGTCTTTCCAAGGGCGGTGTGTGATCTGTGGAGGAGTAGGAATCTCAGATGCCTACTACTGCAAAGAGTGTACACAGCAGGAGAAAGACAGAGATGGATGTCCAAAGATTGTTAACTTAGGCAGTGCAAAAACAGACTTGTTCTATGAACGCAAGAAATATGGGTTCAAGAAACGGTGA ATGGCCAAGCATCATCCCGATTTGATTATGTGCAGAAAGCAGCCAGGAATCGCCATTGGCCGACTTTGTGAGAAGTGCGACGGGAAGTGTGTAATATGTGATTCTTATGTCCGTCCCTGTACTCTCGTTCGGGTTTGTGATGAATGCAATTACGGGTCTTTCCAAGGGCGGTGTGTGATCTGTGGAGGAGTAGGAATCTCAGATGCCTACTACTGCAAAGAGTGTACACAGCAGGAGAAAGACAGAGATGGATGTCCAAAGATTGTTAACTTAGGCAGTGCAAAAACAGACTTGTTCTATGAACGCAAGAAATATGGGTTCAAGAAACGGTGA ATGGCCAAGCATCATCCCGATTTGATTATGTGCAGAAAGCAGCCAGGAATCGCCATTGGCCGACTTTGTGAGAAGTGCGACGGGAAGTGTGTAATATGTGATTCTTATGTCCGTCCCTGTACTCTCGTTCGGGTTTGTGATGAATGCAATTACGGGTCTTTCCAAGGGCGGTGTGTGATCTGTGGAGGAGTAGGAATCTCAGATGCCTACTACTGCAAAGAGTGTACACAGCAGGAGAAAGACAGAGATGGATGTCCAAAGATTGTTAACTTAGGCAGTGCAAAAACAGACTTGTTCTATGAACGCAAGAAATATGGGTTCAAGAAACGGTGA
BLAST of CmoCh13G000480 vs. Swiss-Prot
Match: PHF5A_ARATH (PHD finger-like domain-containing protein 5A OS=Arabidopsis thaliana GN=At2g30000 PE=3 SV=1) HSP 1 Score: 246.9 bits (629), Expect = 1.0e-64 Identity = 109/110 (99.09%), Postives = 110/110 (100.00%), Query Frame = 1
BLAST of CmoCh13G000480 vs. Swiss-Prot
Match: PHF5B_ARATH (PHD finger-like domain-containing protein 5B OS=Arabidopsis thaliana GN=At1g07170 PE=2 SV=1) HSP 1 Score: 246.9 bits (629), Expect = 1.0e-64 Identity = 109/110 (99.09%), Postives = 110/110 (100.00%), Query Frame = 1
BLAST of CmoCh13G000480 vs. Swiss-Prot
Match: PHF5A_HUMAN (PHD finger-like domain-containing protein 5A OS=Homo sapiens GN=PHF5A PE=1 SV=1) HSP 1 Score: 233.4 bits (594), Expect = 1.2e-60 Identity = 101/110 (91.82%), Postives = 106/110 (96.36%), Query Frame = 1
BLAST of CmoCh13G000480 vs. Swiss-Prot
Match: PHF5A_MOUSE (PHD finger-like domain-containing protein 5A OS=Mus musculus GN=Phf5a PE=1 SV=1) HSP 1 Score: 233.4 bits (594), Expect = 1.2e-60 Identity = 101/110 (91.82%), Postives = 106/110 (96.36%), Query Frame = 1
BLAST of CmoCh13G000480 vs. Swiss-Prot
Match: PHF5A_RAT (PHD finger-like domain-containing protein 5A OS=Rattus norvegicus GN=Phf5a PE=2 SV=1) HSP 1 Score: 233.4 bits (594), Expect = 1.2e-60 Identity = 101/110 (91.82%), Postives = 106/110 (96.36%), Query Frame = 1
BLAST of CmoCh13G000480 vs. TrEMBL
Match: K4DCC1_SOLLC (Uncharacterized protein OS=Solanum lycopersicum PE=4 SV=1) HSP 1 Score: 247.3 bits (630), Expect = 8.8e-63 Identity = 110/110 (100.00%), Postives = 110/110 (100.00%), Query Frame = 1
BLAST of CmoCh13G000480 vs. TrEMBL
Match: A0A0V0H5M6_SOLCH (Putative ovule protein OS=Solanum chacoense PE=4 SV=1) HSP 1 Score: 247.3 bits (630), Expect = 8.8e-63 Identity = 110/110 (100.00%), Postives = 110/110 (100.00%), Query Frame = 1
BLAST of CmoCh13G000480 vs. TrEMBL
Match: C6SXE4_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_11G173100 PE=2 SV=1) HSP 1 Score: 247.3 bits (630), Expect = 8.8e-63 Identity = 110/110 (100.00%), Postives = 110/110 (100.00%), Query Frame = 1
BLAST of CmoCh13G000480 vs. TrEMBL
Match: Q01K32_ORYSA (OSIGBa0099L20.4 protein OS=Oryza sativa GN=OSIGBa0099L20.4 PE=4 SV=1) HSP 1 Score: 247.3 bits (630), Expect = 8.8e-63 Identity = 110/110 (100.00%), Postives = 110/110 (100.00%), Query Frame = 1
BLAST of CmoCh13G000480 vs. TrEMBL
Match: A0A0E0PLI0_ORYRU (Uncharacterized protein OS=Oryza rufipogon PE=4 SV=1) HSP 1 Score: 247.3 bits (630), Expect = 8.8e-63 Identity = 110/110 (100.00%), Postives = 110/110 (100.00%), Query Frame = 1
BLAST of CmoCh13G000480 vs. TAIR10
Match: AT1G07170.1 (AT1G07170.1 PHF5-like protein) HSP 1 Score: 246.9 bits (629), Expect = 5.8e-66 Identity = 109/110 (99.09%), Postives = 110/110 (100.00%), Query Frame = 1
BLAST of CmoCh13G000480 vs. TAIR10
Match: AT2G30000.1 (AT2G30000.1 PHF5-like protein) HSP 1 Score: 246.9 bits (629), Expect = 5.8e-66 Identity = 109/110 (99.09%), Postives = 110/110 (100.00%), Query Frame = 1
BLAST of CmoCh13G000480 vs. NCBI nr
Match: gi|351720989|ref|NP_001235659.1| (uncharacterized protein LOC100305969 [Glycine max]) HSP 1 Score: 247.3 bits (630), Expect = 1.3e-62 Identity = 110/110 (100.00%), Postives = 110/110 (100.00%), Query Frame = 1
BLAST of CmoCh13G000480 vs. NCBI nr
Match: gi|226494093|ref|NP_001152699.1| (PHD finger-like domain-containing protein 5A [Zea mays]) HSP 1 Score: 246.9 bits (629), Expect = 1.6e-62 Identity = 109/110 (99.09%), Postives = 110/110 (100.00%), Query Frame = 1
BLAST of CmoCh13G000480 vs. NCBI nr
Match: gi|18390735|ref|NP_563782.1| (splicing factor 3b-like protein [Arabidopsis thaliana]) HSP 1 Score: 246.9 bits (629), Expect = 1.6e-62 Identity = 109/110 (99.09%), Postives = 110/110 (100.00%), Query Frame = 1
BLAST of CmoCh13G000480 vs. NCBI nr
Match: gi|922467047|ref|XP_013633804.1| (PREDICTED: PHD finger-like domain-containing protein 5B [Brassica oleracea var. oleracea]) HSP 1 Score: 246.5 bits (628), Expect = 2.1e-62 Identity = 108/110 (98.18%), Postives = 110/110 (100.00%), Query Frame = 1
BLAST of CmoCh13G000480 vs. NCBI nr
Match: gi|685300614|ref|XP_009141029.1| (PREDICTED: PHD finger-like domain-containing protein 5B [Brassica rapa]) HSP 1 Score: 246.5 bits (628), Expect = 2.1e-62 Identity = 108/110 (98.18%), Postives = 110/110 (100.00%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene: The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene:
|