CmoCh04G020630 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGATAGCGACGCAGGCTGAGATGGTGGAGGCCAGGGTTCCAATTCCTTACAGAGACCAGTGCGCTCACTTGTTGATCCCTCTTAATAAGTGCCGCCAATCCGAGTTCTACCTCCCATGGAAATGCGAAAACGAGCGCCATTCCTACGAGAAATGTGAATATGAGCTCGTTATGGAGAGGATGCTTCAGATGCAGAAGATCCGTGAGGAGGAGGCCAAATTCAAGAAGGGTATTCCTCTCATTCCCAAGACTGCCAATGTATGACGTCATTCCTTAATCAGGTTCGTTTCTCTTGCTCTCTAATCTTCTTAAGCGTTATCGATTCTATTGATATCTTGTTATTTTTACCGTGTCATCGATTTCTCATGATCTTGGTTCGAATGTTCAAAGTTCTATGTTTTCTTTTTCTCCTTTCATATTAGGGCTATGATCTTTCTGAGCTGACACCGGATCGTGGATTGACCCCTATAGCATGA ATGATAGCGACGCAGGCTGAGATGGTGGAGGCCAGGGTTCCAATTCCTTACAGAGACCAGTGCGCTCACTTGTTGATCCCTCTTAATAAGTGCCGCCAATCCGAGTTCTACCTCCCATGGAAATGCGAAAACGAGCGCCATTCCTACGAGAAATGTGAATATGAGCTCGTTATGGAGAGGATGCTTCAGATGCAGAAGATCCGTGAGGAGGAGGCCAAATTCAAGAAGGGTATTCCTCTCATTCCCAAGACTGCCAATGGCTATGATCTTTCTGAGCTGACACCGGATCGTGGATTGACCCCTATAGCATGA ATGATAGCGACGCAGGCTGAGATGGTGGAGGCCAGGGTTCCAATTCCTTACAGAGACCAGTGCGCTCACTTGTTGATCCCTCTTAATAAGTGCCGCCAATCCGAGTTCTACCTCCCATGGAAATGCGAAAACGAGCGCCATTCCTACGAGAAATGTGAATATGAGCTCGTTATGGAGAGGATGCTTCAGATGCAGAAGATCCGTGAGGAGGAGGCCAAATTCAAGAAGGGTATTCCTCTCATTCCCAAGACTGCCAATGGCTATGATCTTTCTGAGCTGACACCGGATCGTGGATTGACCCCTATAGCATGA
BLAST of CmoCh04G020630 vs. Swiss-Prot
Match: NDUB7_ARATH (NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 7 OS=Arabidopsis thaliana GN=At2g02050 PE=3 SV=1) HSP 1 Score: 132.9 bits (333), Expect = 2.0e-30 Identity = 66/93 (70.97%), Postives = 74/93 (79.57%), Query Frame = 1
BLAST of CmoCh04G020630 vs. Swiss-Prot
Match: NDUB7_DICDI (NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 7 OS=Dictyostelium discoideum GN=ndufb7 PE=3 SV=1) HSP 1 Score: 80.1 bits (196), Expect = 1.6e-14 Identity = 38/83 (45.78%), Postives = 57/83 (68.67%), Query Frame = 1
BLAST of CmoCh04G020630 vs. Swiss-Prot
Match: NDUB7_MOUSE (NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 7 OS=Mus musculus GN=Ndufb7 PE=1 SV=3) HSP 1 Score: 60.1 bits (144), Expect = 1.7e-08 Identity = 32/99 (32.32%), Postives = 56/99 (56.57%), Query Frame = 1
BLAST of CmoCh04G020630 vs. Swiss-Prot
Match: NDUB7_PANTR (NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 7 OS=Pan troglodytes GN=NDUFB7 PE=2 SV=3) HSP 1 Score: 59.7 bits (143), Expect = 2.2e-08 Identity = 32/95 (33.68%), Postives = 52/95 (54.74%), Query Frame = 1
BLAST of CmoCh04G020630 vs. Swiss-Prot
Match: NDUB7_GORGO (NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 7 OS=Gorilla gorilla gorilla GN=NDUFB7 PE=2 SV=3) HSP 1 Score: 59.3 bits (142), Expect = 2.8e-08 Identity = 32/95 (33.68%), Postives = 52/95 (54.74%), Query Frame = 1
BLAST of CmoCh04G020630 vs. TrEMBL
Match: A0A0A0KMK8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G277970 PE=4 SV=1) HSP 1 Score: 171.0 bits (432), Expect = 7.5e-40 Identity = 82/86 (95.35%), Postives = 84/86 (97.67%), Query Frame = 1
BLAST of CmoCh04G020630 vs. TrEMBL
Match: V4UAW1_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10017277mg PE=4 SV=1) HSP 1 Score: 163.7 bits (413), Expect = 1.2e-37 Identity = 81/93 (87.10%), Postives = 83/93 (89.25%), Query Frame = 1
BLAST of CmoCh04G020630 vs. TrEMBL
Match: A0A067EXL1_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g034138mg PE=4 SV=1) HSP 1 Score: 163.7 bits (413), Expect = 1.2e-37 Identity = 81/93 (87.10%), Postives = 83/93 (89.25%), Query Frame = 1
BLAST of CmoCh04G020630 vs. TrEMBL
Match: A0A067KTF2_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_04846 PE=4 SV=1) HSP 1 Score: 163.7 bits (413), Expect = 1.2e-37 Identity = 80/92 (86.96%), Postives = 84/92 (91.30%), Query Frame = 1
BLAST of CmoCh04G020630 vs. TrEMBL
Match: M5XML8_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa013794mg PE=4 SV=1) HSP 1 Score: 163.3 bits (412), Expect = 1.6e-37 Identity = 80/92 (86.96%), Postives = 83/92 (90.22%), Query Frame = 1
BLAST of CmoCh04G020630 vs. TAIR10
Match: AT2G02050.1 (AT2G02050.1 NADH-ubiquinone oxidoreductase B18 subunit, putative) HSP 1 Score: 132.9 bits (333), Expect = 1.1e-31 Identity = 66/93 (70.97%), Postives = 74/93 (79.57%), Query Frame = 1
BLAST of CmoCh04G020630 vs. NCBI nr
Match: gi|449445264|ref|XP_004140393.1| (PREDICTED: NADH dehydrogenase [ubiquinone]) HSP 1 Score: 171.0 bits (432), Expect = 1.1e-39 Identity = 82/86 (95.35%), Postives = 84/86 (97.67%), Query Frame = 1
BLAST of CmoCh04G020630 vs. NCBI nr
Match: gi|659120462|ref|XP_008460206.1| (PREDICTED: NADH dehydrogenase [ubiquinone]) HSP 1 Score: 167.2 bits (422), Expect = 1.5e-38 Identity = 80/86 (93.02%), Postives = 83/86 (96.51%), Query Frame = 1
BLAST of CmoCh04G020630 vs. NCBI nr
Match: gi|802597738|ref|XP_012072408.1| (PREDICTED: NADH dehydrogenase [ubiquinone]) HSP 1 Score: 163.7 bits (413), Expect = 1.7e-37 Identity = 80/92 (86.96%), Postives = 84/92 (91.30%), Query Frame = 1
BLAST of CmoCh04G020630 vs. NCBI nr
Match: gi|567911451|ref|XP_006448039.1| (hypothetical protein CICLE_v10017277mg [Citrus clementina]) HSP 1 Score: 163.7 bits (413), Expect = 1.7e-37 Identity = 81/93 (87.10%), Postives = 83/93 (89.25%), Query Frame = 1
BLAST of CmoCh04G020630 vs. NCBI nr
Match: gi|596288639|ref|XP_007225970.1| (hypothetical protein PRUPE_ppa013794mg [Prunus persica]) HSP 1 Score: 163.3 bits (412), Expect = 2.2e-37 Identity = 80/92 (86.96%), Postives = 83/92 (90.22%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|