CmoCh04G015630 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGGTGAGGGTATTGAGAGATTTCAGCGGCGAAGGCGGCGGAGGATTCATAAACGCTCCGACGGTTTTGATATTATGGGCGGCGGTCGTTTCCATTTCTATTATTTCAACCGTCATATTCTCCTGCACCGGCGGCGGCCCCAAGGATAAAACCTCCTCACATTCTGATACATACGGTGCCGCATGTGCTGCCGGCTGTGGAGCCGGCTGCGGCGGTTGA ATGGTGAGGGTATTGAGAGATTTCAGCGGCGAAGGCGGCGGAGGATTCATAAACGCTCCGACGGTTTTGATATTATGGGCGGCGGTCGTTTCCATTTCTATTATTTCAACCGTCATATTCTCCTGCACCGGCGGCGGCCCCAAGGATAAAACCTCCTCACATTCTGATACATACGGTGCCGCATGTGCTGCCGGCTGTGGAGCCGGCTGCGGCGGTTGA ATGGTGAGGGTATTGAGAGATTTCAGCGGCGAAGGCGGCGGAGGATTCATAAACGCTCCGACGGTTTTGATATTATGGGCGGCGGTCGTTTCCATTTCTATTATTTCAACCGTCATATTCTCCTGCACCGGCGGCGGCCCCAAGGATAAAACCTCCTCACATTCTGATACATACGGTGCCGCATGTGCTGCCGGCTGTGGAGCCGGCTGCGGCGGTTGA
BLAST of CmoCh04G015630 vs. TrEMBL
Match: A0A0A0KUK0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G610410 PE=4 SV=1) HSP 1 Score: 90.9 bits (224), Expect = 6.9e-16 Identity = 53/73 (72.60%), Postives = 57/73 (78.08%), Query Frame = 1
BLAST of CmoCh04G015630 vs. TrEMBL
Match: A0A061ECN2_THECC (Uncharacterized protein OS=Theobroma cacao GN=TCM_009475 PE=4 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 4.0e-08 Identity = 34/75 (45.33%), Postives = 49/75 (65.33%), Query Frame = 1
BLAST of CmoCh04G015630 vs. TrEMBL
Match: B9SJW1_RICCO (Putative uncharacterized protein OS=Ricinus communis GN=RCOM_0576720 PE=4 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 5.3e-08 Identity = 39/76 (51.32%), Postives = 52/76 (68.42%), Query Frame = 1
BLAST of CmoCh04G015630 vs. TrEMBL
Match: V4TMG7_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10017364mg PE=4 SV=1) HSP 1 Score: 64.3 bits (155), Expect = 6.9e-08 Identity = 41/77 (53.25%), Postives = 54/77 (70.13%), Query Frame = 1
BLAST of CmoCh04G015630 vs. TrEMBL
Match: A0A0D2PVP6_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_008G157800 PE=4 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 1.2e-07 Identity = 29/51 (56.86%), Postives = 41/51 (80.39%), Query Frame = 1
BLAST of CmoCh04G015630 vs. TAIR10
Match: AT1G68238.1 (AT1G68238.1 unknown protein) HSP 1 Score: 52.4 bits (124), Expect = 1.4e-07 Identity = 28/55 (50.91%), Postives = 36/55 (65.45%), Query Frame = 1
BLAST of CmoCh04G015630 vs. NCBI nr
Match: gi|700196930|gb|KGN52107.1| (hypothetical protein Csa_5G610410 [Cucumis sativus]) HSP 1 Score: 90.9 bits (224), Expect = 9.9e-16 Identity = 53/73 (72.60%), Postives = 57/73 (78.08%), Query Frame = 1
BLAST of CmoCh04G015630 vs. NCBI nr
Match: gi|659066784|ref|XP_008461221.1| (PREDICTED: uncharacterized protein LOC103499844 [Cucumis melo]) HSP 1 Score: 66.6 bits (161), Expect = 2.0e-08 Identity = 35/73 (47.95%), Postives = 47/73 (64.38%), Query Frame = 1
BLAST of CmoCh04G015630 vs. NCBI nr
Match: gi|743920082|ref|XP_011004079.1| (PREDICTED: uncharacterized protein LOC105110673 [Populus euphratica]) HSP 1 Score: 66.2 bits (160), Expect = 2.6e-08 Identity = 34/74 (45.95%), Postives = 50/74 (67.57%), Query Frame = 1
BLAST of CmoCh04G015630 vs. NCBI nr
Match: gi|590693054|ref|XP_007044227.1| (Uncharacterized protein TCM_009475 [Theobroma cacao]) HSP 1 Score: 65.1 bits (157), Expect = 5.8e-08 Identity = 34/75 (45.33%), Postives = 49/75 (65.33%), Query Frame = 1
BLAST of CmoCh04G015630 vs. NCBI nr
Match: gi|223534361|gb|EEF36069.1| (conserved hypothetical protein [Ricinus communis]) HSP 1 Score: 64.7 bits (156), Expect = 7.6e-08 Identity = 39/76 (51.32%), Postives = 52/76 (68.42%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |