CSPI04G07620 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: five_prime_UTRCDSthree_prime_UTR Hold the cursor over a type above to highlight its positions in the sequence below.GAAAATTAAAGAAAGAAAAATAAATATTCTGCATAAAAGAAGTTCTCAGTTTCCCAAATGGAAGCACCTCATTCAACTAGGGTTGTGATTATTGACACCAAGTACGTGCAAACGGATGCCAAGAGCTTCAAGACAGTGGTGCAAAAGCTGACAGGCAAAGATTCGGTGGTGACAGTGGCTGAGGAAACCCGACGACAAACTGGTAGTGCCCGAAACTCGAGTCTTTTGAGAGATTCATCGTTCAAAGAGTTTCAAAGGGTGCTGAGAGAGATGCCAAGAATTGATGAGCTTTATTCTGATTGAAATGAATAGTACATATACATATAGATTATATATATTTTACATATTACTTGATGATCTATGTTACACTTATAGTATTATTTGTACTTTATTGATATAGAATTCT ATGGAAGCACCTCATTCAACTAGGGTTGTGATTATTGACACCAAGTACGTGCAAACGGATGCCAAGAGCTTCAAGACAGTGGTGCAAAAGCTGACAGGCAAAGATTCGGTGGTGACAGTGGCTGAGGAAACCCGACGACAAACTGGTAGTGCCCGAAACTCGAGTCTTTTGAGAGATTCATCGTTCAAAGAGTTTCAAAGGGTGCTGAGAGAGATGCCAAGAATTGATGAGCTTTATTCTGATTGA ATGGAAGCACCTCATTCAACTAGGGTTGTGATTATTGACACCAAGTACGTGCAAACGGATGCCAAGAGCTTCAAGACAGTGGTGCAAAAGCTGACAGGCAAAGATTCGGTGGTGACAGTGGCTGAGGAAACCCGACGACAAACTGGTAGTGCCCGAAACTCGAGTCTTTTGAGAGATTCATCGTTCAAAGAGTTTCAAAGGGTGCTGAGAGAGATGCCAAGAATTGATGAGCTTTATTCTGATTGA
BLAST of CSPI04G07620 vs. Swiss-Prot
Match: VQ10_ARATH (VQ motif-containing protein 10 OS=Arabidopsis thaliana GN=VQ10 PE=1 SV=1) HSP 1 Score: 57.0 bits (136), Expect = 1.1e-07 Identity = 35/92 (38.04%), Postives = 52/92 (56.52%), Query Frame = 1
BLAST of CSPI04G07620 vs. Swiss-Prot
Match: VQ1_ARATH (VQ motif-containing protein 1 OS=Arabidopsis thaliana GN=VQ1 PE=1 SV=1) HSP 1 Score: 53.5 bits (127), Expect = 1.2e-06 Identity = 34/85 (40.00%), Postives = 49/85 (57.65%), Query Frame = 1
BLAST of CSPI04G07620 vs. TrEMBL
Match: A0A0A0KXJ0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G075740 PE=4 SV=1) HSP 1 Score: 154.5 bits (389), Expect = 5.8e-35 Identity = 81/81 (100.00%), Postives = 81/81 (100.00%), Query Frame = 1
BLAST of CSPI04G07620 vs. TrEMBL
Match: A0A0S3SJY7_PHAAN (Uncharacterized protein OS=Vigna angularis var. angularis GN=Vigan.07G207900 PE=4 SV=1) HSP 1 Score: 79.7 bits (195), Expect = 1.8e-12 Identity = 43/76 (56.58%), Postives = 57/76 (75.00%), Query Frame = 1
BLAST of CSPI04G07620 vs. TrEMBL
Match: A0A0L9UJH2_PHAAN (Uncharacterized protein OS=Phaseolus angularis GN=LR48_Vigan05g031100 PE=4 SV=1) HSP 1 Score: 79.7 bits (195), Expect = 1.8e-12 Identity = 43/76 (56.58%), Postives = 57/76 (75.00%), Query Frame = 1
BLAST of CSPI04G07620 vs. TrEMBL
Match: V7BXC0_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_005G051400g PE=4 SV=1) HSP 1 Score: 78.6 bits (192), Expect = 4.0e-12 Identity = 42/76 (55.26%), Postives = 56/76 (73.68%), Query Frame = 1
BLAST of CSPI04G07620 vs. TrEMBL
Match: A0A0B2RBV5_GLYSO (Uncharacterized protein OS=Glycine soja GN=glysoja_034103 PE=4 SV=1) HSP 1 Score: 75.1 bits (183), Expect = 4.4e-11 Identity = 42/78 (53.85%), Postives = 58/78 (74.36%), Query Frame = 1
BLAST of CSPI04G07620 vs. TAIR10
Match: AT1G78410.1 (AT1G78410.1 VQ motif-containing protein) HSP 1 Score: 57.0 bits (136), Expect = 6.3e-09 Identity = 35/92 (38.04%), Postives = 52/92 (56.52%), Query Frame = 1
BLAST of CSPI04G07620 vs. TAIR10
Match: AT1G17147.1 (AT1G17147.1 VQ motif-containing protein) HSP 1 Score: 53.5 bits (127), Expect = 7.0e-08 Identity = 34/85 (40.00%), Postives = 49/85 (57.65%), Query Frame = 1
BLAST of CSPI04G07620 vs. NCBI nr
Match: gi|700198386|gb|KGN53544.1| (hypothetical protein Csa_4G075740 [Cucumis sativus]) HSP 1 Score: 154.5 bits (389), Expect = 8.3e-35 Identity = 81/81 (100.00%), Postives = 81/81 (100.00%), Query Frame = 1
BLAST of CSPI04G07620 vs. NCBI nr
Match: gi|659101790|ref|XP_008451795.1| (PREDICTED: uncharacterized protein LOC103492973 [Cucumis melo]) HSP 1 Score: 145.6 bits (366), Expect = 3.8e-32 Identity = 77/81 (95.06%), Postives = 77/81 (95.06%), Query Frame = 1
BLAST of CSPI04G07620 vs. NCBI nr
Match: gi|920699482|gb|KOM42707.1| (hypothetical protein LR48_Vigan05g031100 [Vigna angularis]) HSP 1 Score: 79.7 bits (195), Expect = 2.6e-12 Identity = 43/76 (56.58%), Postives = 57/76 (75.00%), Query Frame = 1
BLAST of CSPI04G07620 vs. NCBI nr
Match: gi|593697488|ref|XP_007149217.1| (hypothetical protein PHAVU_005G051400g [Phaseolus vulgaris]) HSP 1 Score: 78.6 bits (192), Expect = 5.8e-12 Identity = 42/76 (55.26%), Postives = 56/76 (73.68%), Query Frame = 1
BLAST of CSPI04G07620 vs. NCBI nr
Match: gi|950968160|ref|XP_014499485.1| (PREDICTED: VQ motif-containing protein 1-like [Vigna radiata var. radiata]) HSP 1 Score: 77.8 bits (190), Expect = 9.8e-12 Identity = 44/73 (60.27%), Postives = 54/73 (73.97%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|