Lsi01G020210 (gene) Bottle gourd (USVL1VR-Ls)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGTGATTCCTCCTCCAGTTAAGCCACCAAGATTAACCCAGTATCTAAAGCCATATGTCTTGAAGATGCACTTCACAAACAAGTTTGTGAGTGCCCAAGTGATCCACTCTGAAACAGCCACTGTTGCTTCGGCTGCAAGCTCACAGGAGAAGGCACTGCGGTCGAGCATGGAGTCGACAAGGGATGTGGCTGCTGCTTCAAAGATTGGAAAATTGTTGGGAGAGAGGCTCTTGCTTAAGGGAATCCCAGCTGTTTGTGTGCACTTGAAAAGAGAACAGAAATATCATGGTAAGGTCAAAGCTGTTGTTGATTCCGTGAGGGAAGCAGGTATTAAGCTACTTTGA ATGGTGATTCCTCCTCCAGTTAAGCCACCAAGATTAACCCAGTATCTAAAGCCATATGTCTTGAAGATGCACTTCACAAACAAGTTTGTGAGTGCCCAAGTGATCCACTCTGAAACAGCCACTGTTGCTTCGGCTGCAAGCTCACAGGAGAAGGCACTGCGGTCGAGCATGGAGTCGACAAGGGATGTGGCTGCTGCTTCAAAGATTGGAAAATTGTTGGGAGAGAGGCTCTTGCTTAAGGGAATCCCAGCTGTTTGTGTGCACTTGAAAAGAGAACAGAAATATCATGGTAAGGTCAAAGCTGTTGTTGATTCCGTGAGGGAAGCAGGTATTAAGCTACTTTGA ATGGTGATTCCTCCTCCAGTTAAGCCACCAAGATTAACCCAGTATCTAAAGCCATATGTCTTGAAGATGCACTTCACAAACAAGTTTGTGAGTGCCCAAGTGATCCACTCTGAAACAGCCACTGTTGCTTCGGCTGCAAGCTCACAGGAGAAGGCACTGCGGTCGAGCATGGAGTCGACAAGGGATGTGGCTGCTGCTTCAAAGATTGGAAAATTGTTGGGAGAGAGGCTCTTGCTTAAGGGAATCCCAGCTGTTTGTGTGCACTTGAAAAGAGAACAGAAATATCATGGTAAGGTCAAAGCTGTTGTTGATTCCGTGAGGGAAGCAGGTATTAAGCTACTTTGA MVIPPPVKPPRLTQYLKPYVLKMHFTNKFVSAQVIHSETATVASAASSQEKALRSSMESTRDVAAASKIGKLLGERLLLKGIPAVCVHLKREQKYHGKVKAVVDSVREAGIKLL
BLAST of Lsi01G020210 vs. Swiss-Prot
Match: RL18_AZOC5 (50S ribosomal protein L18 OS=Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / NBRC 14845 / NCIMB 13405 / ORS 571) GN=rplR PE=3 SV=1) HSP 1 Score: 65.5 bits (158), Expect = 4.4e-10 Identity = 41/92 (44.57%), Postives = 56/92 (60.87%), Query Frame = 1
BLAST of Lsi01G020210 vs. Swiss-Prot
Match: RL18_VIBPR (50S ribosomal protein L18 OS=Vibrio proteolyticus GN=rplR PE=3 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 5.7e-10 Identity = 41/92 (44.57%), Postives = 58/92 (63.04%), Query Frame = 1
BLAST of Lsi01G020210 vs. Swiss-Prot
Match: RL18_VIBTL (50S ribosomal protein L18 OS=Vibrio tasmaniensis (strain LGP32) GN=rplR PE=3 SV=1) HSP 1 Score: 64.3 bits (155), Expect = 9.8e-10 Identity = 40/92 (43.48%), Postives = 59/92 (64.13%), Query Frame = 1
BLAST of Lsi01G020210 vs. Swiss-Prot
Match: RL18_SHEB2 (50S ribosomal protein L18 OS=Shewanella baltica (strain OS223) GN=rplR PE=3 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 1.3e-09 Identity = 40/92 (43.48%), Postives = 61/92 (66.30%), Query Frame = 1
BLAST of Lsi01G020210 vs. Swiss-Prot
Match: RL18_SHEB5 (50S ribosomal protein L18 OS=Shewanella baltica (strain OS155 / ATCC BAA-1091) GN=rplR PE=3 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 1.3e-09 Identity = 40/92 (43.48%), Postives = 61/92 (66.30%), Query Frame = 1
BLAST of Lsi01G020210 vs. TrEMBL
Match: A0A0A0L0Z6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G437000 PE=4 SV=1) HSP 1 Score: 205.7 bits (522), Expect = 3.0e-50 Identity = 108/114 (94.74%), Postives = 113/114 (99.12%), Query Frame = 1
BLAST of Lsi01G020210 vs. TrEMBL
Match: A0A059BKV1_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_F00277 PE=4 SV=1) HSP 1 Score: 188.0 bits (476), Expect = 6.5e-45 Identity = 99/114 (86.84%), Postives = 107/114 (93.86%), Query Frame = 1
BLAST of Lsi01G020210 vs. TrEMBL
Match: A0A0B2SGL2_GLYSO (50S ribosomal protein L18 OS=Glycine soja GN=glysoja_026002 PE=4 SV=1) HSP 1 Score: 187.6 bits (475), Expect = 8.5e-45 Identity = 96/114 (84.21%), Postives = 110/114 (96.49%), Query Frame = 1
BLAST of Lsi01G020210 vs. TrEMBL
Match: I1JJR9_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_02G307100 PE=4 SV=1) HSP 1 Score: 187.6 bits (475), Expect = 8.5e-45 Identity = 96/114 (84.21%), Postives = 110/114 (96.49%), Query Frame = 1
BLAST of Lsi01G020210 vs. TrEMBL
Match: A0A061F2F1_THECC (Ribosomal L18p/L5e family protein OS=Theobroma cacao GN=TCM_026668 PE=4 SV=1) HSP 1 Score: 187.2 bits (474), Expect = 1.1e-44 Identity = 98/114 (85.96%), Postives = 110/114 (96.49%), Query Frame = 1
BLAST of Lsi01G020210 vs. TAIR10
Match: AT5G27820.1 (AT5G27820.1 Ribosomal L18p/L5e family protein) HSP 1 Score: 174.9 bits (442), Expect = 2.9e-44 Identity = 91/114 (79.82%), Postives = 103/114 (90.35%), Query Frame = 1
BLAST of Lsi01G020210 vs. TAIR10
Match: AT3G20230.1 (AT3G20230.1 Ribosomal L18p/L5e family protein) HSP 1 Score: 63.2 bits (152), Expect = 1.2e-10 Identity = 33/101 (32.67%), Postives = 62/101 (61.39%), Query Frame = 1
BLAST of Lsi01G020210 vs. TAIR10
Match: AT1G08845.2 (AT1G08845.2 Ribosomal L18p/L5e family protein) HSP 1 Score: 52.4 bits (124), Expect = 2.2e-07 Identity = 29/101 (28.71%), Postives = 53/101 (52.48%), Query Frame = 1
BLAST of Lsi01G020210 vs. NCBI nr
Match: gi|659125466|ref|XP_008462699.1| (PREDICTED: 50S ribosomal protein L18, chloroplastic [Cucumis melo]) HSP 1 Score: 208.4 bits (529), Expect = 6.7e-51 Identity = 110/114 (96.49%), Postives = 113/114 (99.12%), Query Frame = 1
BLAST of Lsi01G020210 vs. NCBI nr
Match: gi|449453185|ref|XP_004144339.1| (PREDICTED: 50S ribosomal protein L18, cyanelle [Cucumis sativus]) HSP 1 Score: 205.7 bits (522), Expect = 4.3e-50 Identity = 108/114 (94.74%), Postives = 113/114 (99.12%), Query Frame = 1
BLAST of Lsi01G020210 vs. NCBI nr
Match: gi|702361554|ref|XP_010059974.1| (PREDICTED: 50S ribosomal protein L18, chloroplastic-like [Eucalyptus grandis]) HSP 1 Score: 188.0 bits (476), Expect = 9.4e-45 Identity = 99/114 (86.84%), Postives = 107/114 (93.86%), Query Frame = 1
BLAST of Lsi01G020210 vs. NCBI nr
Match: gi|571437857|ref|XP_006574357.1| (PREDICTED: uncharacterized protein LOC100526952 isoform X1 [Glycine max]) HSP 1 Score: 187.6 bits (475), Expect = 1.2e-44 Identity = 96/114 (84.21%), Postives = 110/114 (96.49%), Query Frame = 1
BLAST of Lsi01G020210 vs. NCBI nr
Match: gi|590644203|ref|XP_007031018.1| (Ribosomal L18p/L5e family protein [Theobroma cacao]) HSP 1 Score: 187.2 bits (474), Expect = 1.6e-44 Identity = 98/114 (85.96%), Postives = 110/114 (96.49%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Lagenaria siceraria
Date Performed: 2017-09-18
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|