CSPI07G07280 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGACACATATCTGGCAATGGAACGGAAAGGGGGCGGCGCCGGGGTGGTTGATCGAAGGTTTTGCAGATTACACACGACTGCAATCAGGGTACATTCCGAGCCACTGGGTGCCGCCTGGAGGTGGGTCAAATTATACAGATAGTTACGACAAGACAGCAAGATTTATGGACTATTTGGAGAAGAGGACGAGTGGGTTCGTGTCAAAGCTGAATCAAAAGCTCAGAGACGGCTTCTCTCTAGATTAA ATGACACATATCTGGCAATGGAACGGAAAGGGGGCGGCGCCGGGGTGGTTGATCGAAGGTTTTGCAGATTACACACGACTGCAATCAGGGTACATTCCGAGCCACTGGGTGCCGCCTGGAGGTGGGTCAAATTATACAGATAGTTACGACAAGACAGCAAGATTTATGGACTATTTGGAGAAGAGGACGAGTGGGTTCGTGTCAAAGCTGAATCAAAAGCTCAGAGACGGCTTCTCTCTAGATTAA ATGACACATATCTGGCAATGGAACGGAAAGGGGGCGGCGCCGGGGTGGTTGATCGAAGGTTTTGCAGATTACACACGACTGCAATCAGGGTACATTCCGAGCCACTGGGTGCCGCCTGGAGGTGGGTCAAATTATACAGATAGTTACGACAAGACAGCAAGATTTATGGACTATTTGGAGAAGAGGACGAGTGGGTTCGTGTCAAAGCTGAATCAAAAGCTCAGAGACGGCTTCTCTCTAGATTAA
BLAST of CSPI07G07280 vs. TrEMBL
Match: A0A0A0K6G6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G072790 PE=4 SV=1) HSP 1 Score: 180.3 bits (456), Expect = 9.8e-43 Identity = 80/81 (98.77%), Postives = 80/81 (98.77%), Query Frame = 1
BLAST of CSPI07G07280 vs. TrEMBL
Match: A0A0A0K7U8_CUCSA (NtPRp27-like protein OS=Cucumis sativus GN=Csa_7G072780 PE=4 SV=1) HSP 1 Score: 139.0 bits (349), Expect = 2.5e-30 Identity = 58/79 (73.42%), Postives = 67/79 (84.81%), Query Frame = 1
BLAST of CSPI07G07280 vs. TrEMBL
Match: A0A0A0K4M0_CUCSA (NtPRp27-like protein OS=Cucumis sativus GN=Csa_7G072810 PE=4 SV=1) HSP 1 Score: 124.4 bits (311), Expect = 6.4e-26 Identity = 54/79 (68.35%), Postives = 64/79 (81.01%), Query Frame = 1
BLAST of CSPI07G07280 vs. TrEMBL
Match: I6ZPI0_OLEEU (PRp27-like protein OS=Olea europaea subsp. europaea PE=2 SV=1) HSP 1 Score: 121.7 bits (304), Expect = 4.1e-25 Identity = 50/79 (63.29%), Postives = 61/79 (77.22%), Query Frame = 1
BLAST of CSPI07G07280 vs. TrEMBL
Match: M5VHZ4_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa021584mg PE=4 SV=1) HSP 1 Score: 120.9 bits (302), Expect = 7.1e-25 Identity = 49/78 (62.82%), Postives = 62/78 (79.49%), Query Frame = 1
BLAST of CSPI07G07280 vs. TAIR10
Match: AT2G15220.1 (AT2G15220.1 Plant basic secretory protein (BSP) family protein) HSP 1 Score: 111.7 bits (278), Expect = 2.2e-25 Identity = 46/79 (58.23%), Postives = 58/79 (73.42%), Query Frame = 1
BLAST of CSPI07G07280 vs. TAIR10
Match: AT2G15130.1 (AT2G15130.1 Plant basic secretory protein (BSP) family protein) HSP 1 Score: 109.8 bits (273), Expect = 8.2e-25 Identity = 47/85 (55.29%), Postives = 60/85 (70.59%), Query Frame = 1
BLAST of CSPI07G07280 vs. NCBI nr
Match: gi|778730197|ref|XP_004137102.2| (PREDICTED: uncharacterized protein LOC101216547 [Cucumis sativus]) HSP 1 Score: 180.3 bits (456), Expect = 1.4e-42 Identity = 80/81 (98.77%), Postives = 80/81 (98.77%), Query Frame = 1
BLAST of CSPI07G07280 vs. NCBI nr
Match: gi|449438651|ref|XP_004137101.1| (PREDICTED: uncharacterized protein LOC101216297 [Cucumis sativus]) HSP 1 Score: 139.0 bits (349), Expect = 3.6e-30 Identity = 58/79 (73.42%), Postives = 67/79 (84.81%), Query Frame = 1
BLAST of CSPI07G07280 vs. NCBI nr
Match: gi|700188658|gb|KGN43891.1| (NtPRp27-like protein [Cucumis sativus]) HSP 1 Score: 139.0 bits (349), Expect = 3.6e-30 Identity = 58/79 (73.42%), Postives = 67/79 (84.81%), Query Frame = 1
BLAST of CSPI07G07280 vs. NCBI nr
Match: gi|449438369|ref|XP_004136961.1| (PREDICTED: uncharacterized protein LOC101221124 [Cucumis sativus]) HSP 1 Score: 124.4 bits (311), Expect = 9.2e-26 Identity = 54/79 (68.35%), Postives = 64/79 (81.01%), Query Frame = 1
BLAST of CSPI07G07280 vs. NCBI nr
Match: gi|659109990|ref|XP_008454989.1| (PREDICTED: uncharacterized protein LOC103495269 [Cucumis melo]) HSP 1 Score: 122.5 bits (306), Expect = 3.5e-25 Identity = 53/79 (67.09%), Postives = 65/79 (82.28%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |