WMU63092 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CCATCTCCTCGTTTCCCCGATCTGCTGCCAGCCGTTCAAAGTGCTGCACGGCGGAGTATCGGCGTTGATCGCAGAGTCTCTGGCGAGTATGGGCGCTCATACGGCGTCCGGCTACCAGAGAGTCGCCGGAATTCATCCTTTTTTCTCTGTACCTCTCTGCTCTTTTCTTTTCTGCTGGTTATATAGATACATGTAGGCCATAGATTATTCCTTTGTTAATATAATTTCATTTGATC
BLAST of WMU63092 vs. TAIR10
Match: AT1G48320.1 (AT1G48320.1 Thioesterase superfamily protein) HSP 1 Score: 80.1 bits (196), Expect = 6.7e-16 Identity = 38/43 (88.37%), Postives = 39/43 (90.70%), Query Frame = 2
BLAST of WMU63092 vs. TAIR10
Match: AT5G48950.1 (AT5G48950.1 Thioesterase superfamily protein) HSP 1 Score: 73.2 bits (178), Expect = 8.1e-14 Identity = 34/45 (75.56%), Postives = 38/45 (84.44%), Query Frame = 2
BLAST of WMU63092 vs. Swiss-Prot
Match: DNAT1_ARATH (1,4-dihydroxy-2-naphthoyl-CoA thioesterase 1 OS=Arabidopsis thaliana GN=DHNAT1 PE=1 SV=1) HSP 1 Score: 80.1 bits (196), Expect = 1.2e-14 Identity = 38/43 (88.37%), Postives = 39/43 (90.70%), Query Frame = 2
BLAST of WMU63092 vs. Swiss-Prot
Match: DNAT2_ARATH (1,4-dihydroxy-2-naphthoyl-CoA thioesterase 2 OS=Arabidopsis thaliana GN=DHNAT2 PE=2 SV=1) HSP 1 Score: 73.2 bits (178), Expect = 1.4e-12 Identity = 34/45 (75.56%), Postives = 38/45 (84.44%), Query Frame = 2
BLAST of WMU63092 vs. NCBI nr
Match: gi|449459808|ref|XP_004147638.1| (PREDICTED: 1,4-dihydroxy-2-naphthoyl-CoA thioesterase 1-like [Cucumis sativus]) HSP 1 Score: 89.0 bits (219), Expect = 4.1e-15 Identity = 43/44 (97.73%), Postives = 43/44 (97.73%), Query Frame = 2
BLAST of WMU63092 vs. NCBI nr
Match: gi|659077071|ref|XP_008439017.1| (PREDICTED: uncharacterized protein LOC103483935 [Cucumis melo]) HSP 1 Score: 85.9 bits (211), Expect = 3.4e-14 Identity = 42/44 (95.45%), Postives = 42/44 (95.45%), Query Frame = 2
BLAST of WMU63092 vs. NCBI nr
Match: gi|848921645|ref|XP_012857487.1| (PREDICTED: 1,4-dihydroxy-2-naphthoyl-CoA thioesterase 1-like [Erythranthe guttata]) HSP 1 Score: 82.0 bits (201), Expect = 5.0e-13 Identity = 37/45 (82.22%), Postives = 42/45 (93.33%), Query Frame = 2
BLAST of WMU63092 vs. NCBI nr
Match: gi|947123603|gb|KRH71809.1| (hypothetical protein GLYMA_02G170200, partial [Glycine max]) HSP 1 Score: 81.3 bits (199), Expect = 8.5e-13 Identity = 44/61 (72.13%), Postives = 47/61 (77.05%), Query Frame = 2
BLAST of WMU63092 vs. NCBI nr
Match: gi|734369535|gb|KHN19125.1| (Putative esterase, partial [Glycine soja]) HSP 1 Score: 80.1 bits (196), Expect = 1.9e-12 Identity = 39/44 (88.64%), Postives = 40/44 (90.91%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|