CU091730 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ATTGAGTAGGGGTAAAGATGATGATAAGCTAGATCGGTTCCAATCATCCCAAGCTGAATGGATCAAACAGTATGTAGAGCAGCAAGAAGAGGATGACTATGGAATCTGGGAAGATAACATGGCTGATGAAGGTTCTTCGAAAGAAGGCTTCGCAAGCAAGGTCCTATGATGTTATTGCGGAAGAGTATTATGCTGCACGGTTGGACGCTGCAAAAGCAAAAGGAAGAAGGGGACAAGAAAAGACAAGAGACTGCTGGCAACATCATTCGCAAGCTTAAAACAGGAGTTGTTAGCTCAAGGATTATCAGTTGATATGCTGGCTTC
BLAST of CU091730 vs. TrEMBL
Match: A0A0A0L9G2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G229400 PE=4 SV=1) HSP 1 Score: 102.1 bits (253), Expect = 4.4e-19 Identity = 47/48 (97.92%), Postives = 48/48 (100.00%), Query Frame = 2
BLAST of CU091730 vs. TrEMBL
Match: A0A0A0L9G2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G229400 PE=4 SV=1) HSP 1 Score: 55.5 bits (132), Expect = 4.8e-05 Identity = 29/37 (78.38%), Postives = 32/37 (86.49%), Query Frame = 3
HSP 2 Score: 44.7 bits (104), Expect = 8.5e-02 Identity = 21/22 (95.45%), Postives = 21/22 (95.45%), Query Frame = 1
HSP 3 Score: 60.5 bits (145), Expect = 1.5e-06 Identity = 26/44 (59.09%), Postives = 33/44 (75.00%), Query Frame = 2
BLAST of CU091730 vs. TrEMBL
Match: A0A059B954_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_G00347 PE=4 SV=1) HSP 1 Score: 39.7 bits (91), Expect = 2.7e+00 Identity = 21/37 (56.76%), Postives = 27/37 (72.97%), Query Frame = 3
HSP 2 Score: 58.2 bits (139), Expect = 7.3e-06 Identity = 25/44 (56.82%), Postives = 33/44 (75.00%), Query Frame = 2
BLAST of CU091730 vs. TrEMBL
Match: A0A0D2RAF0_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_002G216000 PE=4 SV=1) HSP 1 Score: 58.2 bits (139), Expect = 7.3e-06 Identity = 24/44 (54.55%), Postives = 35/44 (79.55%), Query Frame = 2
BLAST of CU091730 vs. TrEMBL
Match: A0A0D2RAF0_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_002G216000 PE=4 SV=1) HSP 1 Score: 40.4 bits (93), Expect = 1.6e+00 Identity = 21/37 (56.76%), Postives = 28/37 (75.68%), Query Frame = 3
HSP 2 Score: 58.2 bits (139), Expect = 7.3e-06 Identity = 24/44 (54.55%), Postives = 35/44 (79.55%), Query Frame = 2
BLAST of CU091730 vs. NCBI nr
Match: gi|778680315|ref|XP_011651288.1| (PREDICTED: ATP-dependent RNA helicase DHX36 isoform X2 [Cucumis sativus]) HSP 1 Score: 107.8 bits (268), Expect = 1.2e-20 Identity = 63/107 (58.88%), Postives = 67/107 (62.62%), Query Frame = 2
BLAST of CU091730 vs. NCBI nr
Match: gi|778680313|ref|XP_011651287.1| (PREDICTED: ATP-dependent RNA helicase DHX29 isoform X1 [Cucumis sativus]) HSP 1 Score: 107.8 bits (268), Expect = 1.2e-20 Identity = 63/107 (58.88%), Postives = 67/107 (62.62%), Query Frame = 2
BLAST of CU091730 vs. NCBI nr
Match: gi|659112042|ref|XP_008456037.1| (PREDICTED: ATP-dependent RNA helicase DHX36 isoform X2 [Cucumis melo]) HSP 1 Score: 103.2 bits (256), Expect = 2.9e-19 Identity = 61/107 (57.01%), Postives = 65/107 (60.75%), Query Frame = 2
BLAST of CU091730 vs. NCBI nr
Match: gi|659112040|ref|XP_008456036.1| (PREDICTED: ATP-dependent RNA helicase DHX29 isoform X1 [Cucumis melo]) HSP 1 Score: 103.2 bits (256), Expect = 2.9e-19 Identity = 61/107 (57.01%), Postives = 65/107 (60.75%), Query Frame = 2
BLAST of CU091730 vs. NCBI nr
Match: gi|700202481|gb|KGN57614.1| (hypothetical protein Csa_3G229400 [Cucumis sativus]) HSP 1 Score: 98.2 bits (243), Expect = 9.2e-18 Identity = 47/48 (97.92%), Postives = 48/48 (100.00%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|