CU086533 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGAAAACATTAGTGAGAAAGTTGACAGGCATTGTTTTGGTCCTAGATTCAGAGTTTTTCCACCAGCTACTCTTTTTCTACAATGCAAAACACATCGATGTTTTTATGGTTCTTGTAGAGGCTTGTCGGTTACTTCGGAAATTTGTGCAAGAAAATGGGGATATGTTGAGCATTTTCGCTGGCAAGGATTATTTACTTAACAAGGCCTTAGTGGATTAGAGAGTTAAGAAATTTGCATATGCTTGCATCCAGACTGTACACCATAATAGGTAATTAGTTTTTCCATTTCAACATTCCTTATTAAAAACTTATCCTTTTTAACGTTTTGAATGGAAAAACAGATGTTTGATCTATCATTGTTGATTTTGTTGGCTTTCTATGCTATGATCCTTTAATTGTATATGATATATTT
BLAST of CU086533 vs. Swiss-Prot
Match: UPL6_ARATH (E3 ubiquitin-protein ligase UPL6 OS=Arabidopsis thaliana GN=UPL6 PE=2 SV=1) HSP 1 Score: 82.0 bits (201), Expect = 5.5e-15 Identity = 37/74 (50.00%), Postives = 49/74 (66.22%), Query Frame = 1
BLAST of CU086533 vs. TrEMBL
Match: A0A0A0KCV0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G000010 PE=4 SV=1) HSP 1 Score: 115.2 bits (287), Expect = 6.6e-23 Identity = 56/57 (98.25%), Postives = 56/57 (98.25%), Query Frame = 1
BLAST of CU086533 vs. TrEMBL
Match: A0A0A0KCV0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G000010 PE=4 SV=1) HSP 1 Score: 30.4 bits (67), Expect = 2.1e+03 Identity = 13/25 (52.00%), Postives = 13/25 (52.00%), Query Frame = 3
HSP 2 Score: 98.2 bits (243), Expect = 8.3e-18 Identity = 43/75 (57.33%), Postives = 60/75 (80.00%), Query Frame = 1
BLAST of CU086533 vs. TrEMBL
Match: A0A0L9VEG6_PHAAN (Uncharacterized protein OS=Phaseolus angularis GN=LR48_Vigan09g172800 PE=4 SV=1) HSP 1 Score: 98.2 bits (243), Expect = 8.3e-18 Identity = 43/75 (57.33%), Postives = 60/75 (80.00%), Query Frame = 1
BLAST of CU086533 vs. TrEMBL
Match: V4RF96_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10004231mg PE=4 SV=1) HSP 1 Score: 97.4 bits (241), Expect = 1.4e-17 Identity = 45/74 (60.81%), Postives = 57/74 (77.03%), Query Frame = 1
BLAST of CU086533 vs. TrEMBL
Match: V4RXS5_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10004231mg PE=4 SV=1) HSP 1 Score: 97.4 bits (241), Expect = 1.4e-17 Identity = 45/74 (60.81%), Postives = 57/74 (77.03%), Query Frame = 1
BLAST of CU086533 vs. NCBI nr
Match: gi|778708897|ref|XP_011656310.1| (PREDICTED: LOW QUALITY PROTEIN: E3 ubiquitin-protein ligase UPL6 [Cucumis sativus]) HSP 1 Score: 151.8 bits (382), Expect = 9.1e-34 Identity = 73/75 (97.33%), Postives = 73/75 (97.33%), Query Frame = 1
BLAST of CU086533 vs. NCBI nr
Match: gi|659116902|ref|XP_008458320.1| (PREDICTED: LOW QUALITY PROTEIN: E3 ubiquitin-protein ligase UPL6 [Cucumis melo]) HSP 1 Score: 147.9 bits (372), Expect = 1.3e-32 Identity = 71/75 (94.67%), Postives = 72/75 (96.00%), Query Frame = 1
BLAST of CU086533 vs. NCBI nr
Match: gi|700190397|gb|KGN45601.1| (hypothetical protein Csa_6G000010 [Cucumis sativus]) HSP 1 Score: 115.9 bits (289), Expect = 5.5e-23 Identity = 56/57 (98.25%), Postives = 56/57 (98.25%), Query Frame = 1
BLAST of CU086533 vs. NCBI nr
Match: gi|965600573|dbj|BAT87751.1| (hypothetical protein VIGAN_05114800 [Vigna angularis var. angularis]) HSP 1 Score: 100.1 bits (248), Expect = 3.1e-18 Identity = 43/75 (57.33%), Postives = 60/75 (80.00%), Query Frame = 1
BLAST of CU086533 vs. NCBI nr
Match: gi|920711820|gb|KOM53069.1| (hypothetical protein LR48_Vigan09g172800 [Vigna angularis]) HSP 1 Score: 100.1 bits (248), Expect = 3.1e-18 Identity = 43/75 (57.33%), Postives = 60/75 (80.00%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|