Cucsa.105790 (gene) Cucumber (Gy14) v1
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGATTAACACTCACCCAATTCCTCCTCTTTACAACACTTTCTTCCCCCACTCTCCTCCCCCGGATTCCCAACTCGACGGAATCGCCGCCGTCGTCGGTCGTCAAGTCCTCTTCGGCGACAACCGACCCACACCCACTAAATCCTCATCCTCGACGTCGGCAACGGCACCGACGACGGGGCAGAGGAGTTACCGAGGAGTGCGGAAGCGGCCGTGGGGGAGATGGTCGGCGGAGATTCGTGACCGAATAGGGCGGTGCCGGCATTGGCTTGGGACGTTCGACACGGCAGAAGAAGCGGCGCGTGCGTACGACGCGGCGGCGAGGCGGTTGAGAGGGTCGAAAGCAAGAaCGAATTTTGAAATGCCGTTGGTCGTCCCGATGGAGTCCACGTCAGCGTGGTCTACGTCATCAGTGGAAGTGAAAAGAAATG ATGATTAACACTCACCCAATTCCTCCTCTTTACAACACTTTCTTCCCCCACTCTCCTCCCCCGGATTCCCAACTCGACGGAATCGCCGCCGTCGTCGGTCGTCAAGTCCTCTTCGGCGACAACCGACCCACACCCACTAAATCCTCATCCTCGACGTCGGCAACGGCACCGACGACGGGGCAGAGGAGTTACCGAGGAGTGCGGAAGCGGCCGTGGGGGAGATGGTCGGCGGAGATTCGTGACCGAATAGGGCGGTGCCGGCATTGGCTTGGGACGTTCGACACGGCAGAAGAAGCGGCGCGTGCGTACGACGCGGCGGCGAGGCGGTTGAGAGGGTCGAAAGCAAGAACGAATTTTGAAATGCCGTTGGTCGTCCCGATGGAGTCCACGTCAGCGTGGTCTACGTCATCAGTGGAAGTGAAAAGAAATG ATGATTAACACTCACCCAATTCCTCCTCTTTACAACACTTTCTTCCCCCACTCTCCTCCCCCGGATTCCCAACTCGACGGAATCGCCGCCGTCGTCGGTCGTCAAGTCCTCTTCGGCGACAACCGACCCACACCCACTAAATCCTCATCCTCGACGTCGGCAACGGCACCGACGACGGGGCAGAGGAGTTACCGAGGAGTGCGGAAGCGGCCGTGGGGGAGATGGTCGGCGGAGATTCGTGACCGAATAGGGCGGTGCCGGCATTGGCTTGGGACGTTCGACACGGCAGAAGAAGCGGCGCGTGCGTACGACGCGGCGGCGAGGCGGTTGAGAGGGTCGAAAGCAAGAaCGAATTTTGAAATGCCGTTGGTCGTCCCGATGGAGTCCACGTCAGCGTGGTCTACGTCATCAGTGGAAGTGAAAAGAAATG MINTHPIPPLYNTFFPHSPPPDSQLDGIAAVVGRQVLFGDNRPTPTKSSSSTSATAPTTGQRSYRGVRKRPWGRWSAEIRDRIGRCRHWLGTFDTAEEAARAYDAAARRLRGSKARTNFEMPLVVPMESTSAWSTSSVEVKRNX
BLAST of Cucsa.105790 vs. Swiss-Prot
Match: ERF84_ARATH (Ethylene-responsive transcription factor ERF084 OS=Arabidopsis thaliana GN=ERF084 PE=2 SV=1) HSP 1 Score: 138.7 bits (348), Expect = 5.2e-32 Identity = 74/140 (52.86%), Postives = 87/140 (62.14%), Query Frame = 1
BLAST of Cucsa.105790 vs. Swiss-Prot
Match: ESR1_ARATH (Ethylene-responsive transcription factor ESR1 OS=Arabidopsis thaliana GN=ESR1 PE=1 SV=1) HSP 1 Score: 100.5 bits (249), Expect = 1.6e-20 Identity = 56/111 (50.45%), Postives = 70/111 (63.06%), Query Frame = 1
BLAST of Cucsa.105790 vs. Swiss-Prot
Match: RAP22_ARATH (Ethylene-responsive transcription factor RAP2-2 OS=Arabidopsis thaliana GN=RAP2-2 PE=1 SV=2) HSP 1 Score: 97.8 bits (242), Expect = 1.0e-19 Identity = 48/89 (53.93%), Postives = 62/89 (69.66%), Query Frame = 1
BLAST of Cucsa.105790 vs. Swiss-Prot
Match: ESR2_ARATH (Ethylene-responsive transcription factor ESR2 OS=Arabidopsis thaliana GN=ESR2 PE=1 SV=1) HSP 1 Score: 97.1 bits (240), Expect = 1.7e-19 Identity = 48/80 (60.00%), Postives = 60/80 (75.00%), Query Frame = 1
BLAST of Cucsa.105790 vs. Swiss-Prot
Match: ERF79_ARATH (Ethylene-responsive transcription factor 8 OS=Arabidopsis thaliana GN=ERF8 PE=2 SV=1) HSP 1 Score: 96.3 bits (238), Expect = 2.9e-19 Identity = 45/78 (57.69%), Postives = 57/78 (73.08%), Query Frame = 1
BLAST of Cucsa.105790 vs. TrEMBL
Match: A0A0A0KA16_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G432130 PE=4 SV=1) HSP 1 Score: 297.7 bits (761), Expect = 7.4e-78 Identity = 143/143 (100.00%), Postives = 143/143 (100.00%), Query Frame = 1
BLAST of Cucsa.105790 vs. TrEMBL
Match: A0A067KL79_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_06067 PE=4 SV=1) HSP 1 Score: 162.9 bits (411), Expect = 2.8e-37 Identity = 90/155 (58.06%), Postives = 105/155 (67.74%), Query Frame = 1
BLAST of Cucsa.105790 vs. TrEMBL
Match: F6HXS1_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_09s0002g08830 PE=4 SV=1) HSP 1 Score: 161.0 bits (406), Expect = 1.1e-36 Identity = 86/138 (62.32%), Postives = 97/138 (70.29%), Query Frame = 1
BLAST of Cucsa.105790 vs. TrEMBL
Match: A0A0D2TPB1_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_009G125700 PE=4 SV=1) HSP 1 Score: 161.0 bits (406), Expect = 1.1e-36 Identity = 86/146 (58.90%), Postives = 101/146 (69.18%), Query Frame = 1
BLAST of Cucsa.105790 vs. TrEMBL
Match: A0A067DJU7_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g047950mg PE=4 SV=1) HSP 1 Score: 160.2 bits (404), Expect = 1.8e-36 Identity = 86/131 (65.65%), Postives = 97/131 (74.05%), Query Frame = 1
BLAST of Cucsa.105790 vs. TAIR10
Match: AT1G80580.1 (AT1G80580.1 Integrase-type DNA-binding superfamily protein) HSP 1 Score: 138.7 bits (348), Expect = 2.9e-33 Identity = 74/140 (52.86%), Postives = 87/140 (62.14%), Query Frame = 1
BLAST of Cucsa.105790 vs. TAIR10
Match: AT1G12980.1 (AT1G12980.1 Integrase-type DNA-binding superfamily protein) HSP 1 Score: 100.5 bits (249), Expect = 8.8e-22 Identity = 56/111 (50.45%), Postives = 70/111 (63.06%), Query Frame = 1
BLAST of Cucsa.105790 vs. TAIR10
Match: AT3G14230.1 (AT3G14230.1 related to AP2 2) HSP 1 Score: 97.8 bits (242), Expect = 5.7e-21 Identity = 48/89 (53.93%), Postives = 62/89 (69.66%), Query Frame = 1
BLAST of Cucsa.105790 vs. TAIR10
Match: AT1G24590.1 (AT1G24590.1 DORNROSCHEN-like) HSP 1 Score: 97.1 bits (240), Expect = 9.7e-21 Identity = 48/80 (60.00%), Postives = 60/80 (75.00%), Query Frame = 1
BLAST of Cucsa.105790 vs. TAIR10
Match: AT1G53170.1 (AT1G53170.1 ethylene response factor 8) HSP 1 Score: 96.3 bits (238), Expect = 1.7e-20 Identity = 45/78 (57.69%), Postives = 57/78 (73.08%), Query Frame = 1
BLAST of Cucsa.105790 vs. NCBI nr
Match: gi|700189999|gb|KGN45232.1| (hypothetical protein Csa_7G432130 [Cucumis sativus]) HSP 1 Score: 297.7 bits (761), Expect = 1.1e-77 Identity = 143/143 (100.00%), Postives = 143/143 (100.00%), Query Frame = 1
BLAST of Cucsa.105790 vs. NCBI nr
Match: gi|659122982|ref|XP_008461426.1| (PREDICTED: ethylene-responsive transcription factor ERF084 [Cucumis melo]) HSP 1 Score: 279.3 bits (713), Expect = 3.9e-72 Identity = 138/148 (93.24%), Postives = 142/148 (95.95%), Query Frame = 1
BLAST of Cucsa.105790 vs. NCBI nr
Match: gi|297743600|emb|CBI36467.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 164.5 bits (415), Expect = 1.4e-37 Identity = 88/123 (71.54%), Postives = 97/123 (78.86%), Query Frame = 1
BLAST of Cucsa.105790 vs. NCBI nr
Match: gi|643729131|gb|KDP37011.1| (hypothetical protein JCGZ_06067 [Jatropha curcas]) HSP 1 Score: 162.9 bits (411), Expect = 4.1e-37 Identity = 90/155 (58.06%), Postives = 105/155 (67.74%), Query Frame = 1
BLAST of Cucsa.105790 vs. NCBI nr
Match: gi|802604074|ref|XP_012073423.1| (PREDICTED: ethylene-responsive transcription factor ERF084 [Jatropha curcas]) HSP 1 Score: 162.9 bits (411), Expect = 4.1e-37 Identity = 90/155 (58.06%), Postives = 105/155 (67.74%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (Gy14)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene: The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|