Csa1G004210 (gene) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGTTGATGGTGACATAATTTAAAAGCTGATGAGACGATCTTAGCATTTCAATATAATATATAGTTTTTTAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAATTAA ATGTTGATGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAATTAA ATGTTGATGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAATTAA MLMKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKN*
BLAST of Csa1G004210 vs. Swiss-Prot
Match: Y5G8_ENCCU (UPF0329 protein ECU05_1680/ECU11_0050 OS=Encephalitozoon cuniculi (strain GB-M1) GN=ECU05_1680 PE=3 SV=1) HSP 1 Score: 98.2 bits (243), Expect = 6.5e-20 Identity = 44/111 (39.64%), Postives = 87/111 (78.38%), Query Frame = 1
BLAST of Csa1G004210 vs. Swiss-Prot
Match: NST1_CANGA (Stress response protein NST1 OS=Candida glabrata (strain ATCC 2001 / CBS 138 / JCM 3761 / NBRC 0622 / NRRL Y-65) GN=NST1 PE=3 SV=1) HSP 1 Score: 93.2 bits (230), Expect = 2.1e-18 Identity = 33/117 (28.21%), Postives = 99/117 (84.62%), Query Frame = 1
BLAST of Csa1G004210 vs. Swiss-Prot
Match: GARP_PLAFF (Glutamic acid-rich protein OS=Plasmodium falciparum (isolate FC27 / Papua New Guinea) GN=GARP PE=4 SV=1) HSP 1 Score: 92.0 bits (227), Expect = 4.7e-18 Identity = 49/150 (32.67%), Postives = 95/150 (63.33%), Query Frame = 1
BLAST of Csa1G004210 vs. Swiss-Prot
Match: NST1_KLULA (Stress response protein NST1 OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) GN=NST1 PE=3 SV=1) HSP 1 Score: 90.9 bits (224), Expect = 1.0e-17 Identity = 35/117 (29.91%), Postives = 96/117 (82.05%), Query Frame = 1
BLAST of Csa1G004210 vs. Swiss-Prot
Match: NST1_DEBHA (Stress response protein NST1 OS=Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / JCM 1990 / NBRC 0083 / IGC 2968) GN=NST1 PE=3 SV=2) HSP 1 Score: 89.7 bits (221), Expect = 2.3e-17 Identity = 36/117 (30.77%), Postives = 94/117 (80.34%), Query Frame = 1
BLAST of Csa1G004210 vs. TrEMBL
Match: A0A0A0LRF1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G004210 PE=4 SV=1) HSP 1 Score: 235.7 bits (600), Expect = 2.9e-59 Identity = 120/120 (100.00%), Postives = 120/120 (100.00%), Query Frame = 1
BLAST of Csa1G004210 vs. TrEMBL
Match: A0A085M3T2_9BILA (Uncharacterized protein (Fragment) OS=Trichuris suis GN=M513_07207 PE=4 SV=1) HSP 1 Score: 232.6 bits (592), Expect = 2.5e-58 Identity = 118/119 (99.16%), Postives = 119/119 (100.00%), Query Frame = 1
BLAST of Csa1G004210 vs. TrEMBL
Match: A0A0A0K9J0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G092520 PE=4 SV=1) HSP 1 Score: 231.5 bits (589), Expect = 5.5e-58 Identity = 117/119 (98.32%), Postives = 119/119 (100.00%), Query Frame = 1
BLAST of Csa1G004210 vs. TrEMBL
Match: A0A0A0K9J0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G092520 PE=4 SV=1) HSP 1 Score: 220.7 bits (561), Expect = 9.7e-55 Identity = 115/124 (92.74%), Postives = 117/124 (94.35%), Query Frame = 1
HSP 2 Score: 231.1 bits (588), Expect = 7.2e-58 Identity = 118/119 (99.16%), Postives = 118/119 (99.16%), Query Frame = 1
BLAST of Csa1G004210 vs. TrEMBL
Match: A0A091DRC2_FUKDA (Uncharacterized protein OS=Fukomys damarensis GN=H920_13292 PE=4 SV=1) HSP 1 Score: 230.3 bits (586), Expect = 1.2e-57 Identity = 117/119 (98.32%), Postives = 118/119 (99.16%), Query Frame = 1
BLAST of Csa1G004210 vs. TAIR10
Match: AT3G28770.1 (AT3G28770.1 Protein of unknown function (DUF1216)) HSP 1 Score: 95.5 bits (236), Expect = 2.4e-20 Identity = 46/117 (39.32%), Postives = 77/117 (65.81%), Query Frame = 1
HSP 2 Score: 93.6 bits (231), Expect = 9.0e-20 Identity = 43/118 (36.44%), Postives = 79/118 (66.95%), Query Frame = 1
HSP 3 Score: 92.4 bits (228), Expect = 2.0e-19 Identity = 47/121 (38.84%), Postives = 78/121 (64.46%), Query Frame = 1
BLAST of Csa1G004210 vs. TAIR10
Match: AT1G56660.1 (AT1G56660.1 unknown protein) HSP 1 Score: 88.6 bits (218), Expect = 2.9e-18 Identity = 56/144 (38.89%), Postives = 79/144 (54.86%), Query Frame = 1
BLAST of Csa1G004210 vs. TAIR10
Match: AT5G40340.1 (AT5G40340.1 Tudor/PWWP/MBT superfamily protein) HSP 1 Score: 85.5 bits (210), Expect = 2.5e-17 Identity = 42/128 (32.81%), Postives = 80/128 (62.50%), Query Frame = 1
BLAST of Csa1G004210 vs. TAIR10
Match: AT5G55820.1 (AT5G55820.1 Inner centromere protein, ARK-binding region (InterPro:IPR005635)) HSP 1 Score: 68.2 bits (165), Expect = 4.1e-12 Identity = 30/116 (25.86%), Postives = 80/116 (68.97%), Query Frame = 1
HSP 2 Score: 48.1 bits (113), Expect = 4.3e-06 Identity = 21/117 (17.95%), Postives = 64/117 (54.70%), Query Frame = 1
BLAST of Csa1G004210 vs. TAIR10
Match: AT2G39320.1 (AT2G39320.1 Cysteine proteinases superfamily protein) HSP 1 Score: 64.7 bits (156), Expect = 4.5e-11 Identity = 29/61 (47.54%), Postives = 47/61 (77.05%), Query Frame = 1
BLAST of Csa1G004210 vs. NCBI nr
Match: gi|700208458|gb|KGN63554.1| (hypothetical protein Csa_1G004210 [Cucumis sativus]) HSP 1 Score: 235.7 bits (600), Expect = 4.2e-59 Identity = 120/120 (100.00%), Postives = 120/120 (100.00%), Query Frame = 1
BLAST of Csa1G004210 vs. NCBI nr
Match: gi|669308377|gb|KFD51878.1| (hypothetical protein M513_07207, partial [Trichuris suis]) HSP 1 Score: 232.6 bits (592), Expect = 3.5e-58 Identity = 118/119 (99.16%), Postives = 119/119 (100.00%), Query Frame = 1
BLAST of Csa1G004210 vs. NCBI nr
Match: gi|700191226|gb|KGN46430.1| (hypothetical protein Csa_6G092520 [Cucumis sativus]) HSP 1 Score: 231.5 bits (589), Expect = 7.9e-58 Identity = 117/119 (98.32%), Postives = 119/119 (100.00%), Query Frame = 1
BLAST of Csa1G004210 vs. NCBI nr
Match: gi|700191226|gb|KGN46430.1| (hypothetical protein Csa_6G092520 [Cucumis sativus]) HSP 1 Score: 220.7 bits (561), Expect = 1.4e-54 Identity = 115/124 (92.74%), Postives = 117/124 (94.35%), Query Frame = 1
HSP 2 Score: 230.3 bits (586), Expect = 1.8e-57 Identity = 117/119 (98.32%), Postives = 118/119 (99.16%), Query Frame = 1
BLAST of Csa1G004210 vs. NCBI nr
Match: gi|632911274|gb|KDB11191.1| (hypothetical protein UV8b_7924 [Ustilaginoidea virens]) HSP 1 Score: 229.9 bits (585), Expect = 2.3e-57 Identity = 117/117 (100.00%), Postives = 117/117 (100.00%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
This gene is associated with the following unigenes:
The following mRNA feature(s) are a part of this gene:
The following transcribed_cluster feature(s) are associated with this gene:
Analysis Name: InterPro Annotations of cucumber (Chinese Long)
Date Performed: 2016-09-28
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |