CmoCh19G007180 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGGGATTCCGCTTGATAAACAGCCCTAGAAAATCGTCATCGACTGTTCCGAAGGGGTTTTTCGCCGTGTACGTCGGAGAGACCCAAAAGAGACGACATGTGATTCCGATTTCTTACTTGAAGCATCCGTCGTTTCAAGATTTGTTGAGTAAAGCCGAAGAAGAGTTCGGATTCGATCATCCGATGGGCGGCTTGACGATCCCTTGCAACGAAGATGTGTTCTTCGAAGTCACTTCTCGATTGGCGGCTAATTGTTGA ATGGGATTCCGCTTGATAAACAGCCCTAGAAAATCGTCATCGACTGTTCCGAAGGGGTTTTTCGCCGTGTACGTCGGAGAGACCCAAAAGAGACGACATGTGATTCCGATTTCTTACTTGAAGCATCCGTCGTTTCAAGATTTGTTGAGTAAAGCCGAAGAAGAGTTCGGATTCGATCATCCGATGGGCGGCTTGACGATCCCTTGCAACGAAGATGTGTTCTTCGAAGTCACTTCTCGATTGGCGGCTAATTGTTGA ATGGGATTCCGCTTGATAAACAGCCCTAGAAAATCGTCATCGACTGTTCCGAAGGGGTTTTTCGCCGTGTACGTCGGAGAGACCCAAAAGAGACGACATGTGATTCCGATTTCTTACTTGAAGCATCCGTCGTTTCAAGATTTGTTGAGTAAAGCCGAAGAAGAGTTCGGATTCGATCATCCGATGGGCGGCTTGACGATCCCTTGCAACGAAGATGTGTTCTTCGAAGTCACTTCTCGATTGGCGGCTAATTGTTGA
BLAST of CmoCh19G007180 vs. Swiss-Prot
Match: SAU21_ARATH (Auxin-responsive protein SAUR21 OS=Arabidopsis thaliana GN=SAUR21 PE=2 SV=1) HSP 1 Score: 118.2 bits (295), Expect = 4.3e-26 Identity = 52/72 (72.22%), Postives = 61/72 (84.72%), Query Frame = 1
BLAST of CmoCh19G007180 vs. Swiss-Prot
Match: SAU24_ARATH (Auxin-responsive protein SAUR24 OS=Arabidopsis thaliana GN=SAUR24 PE=2 SV=1) HSP 1 Score: 117.5 bits (293), Expect = 7.3e-26 Identity = 51/78 (65.38%), Postives = 63/78 (80.77%), Query Frame = 1
BLAST of CmoCh19G007180 vs. Swiss-Prot
Match: SAU20_ARATH (Auxin-responsive protein SAUR20 OS=Arabidopsis thaliana GN=SAUR20 PE=2 SV=1) HSP 1 Score: 117.1 bits (292), Expect = 9.5e-26 Identity = 51/77 (66.23%), Postives = 63/77 (81.82%), Query Frame = 1
BLAST of CmoCh19G007180 vs. Swiss-Prot
Match: SAU22_ARATH (Auxin-responsive protein SAUR22 OS=Arabidopsis thaliana GN=SAUR22 PE=2 SV=1) HSP 1 Score: 116.7 bits (291), Expect = 1.2e-25 Identity = 50/78 (64.10%), Postives = 64/78 (82.05%), Query Frame = 1
BLAST of CmoCh19G007180 vs. Swiss-Prot
Match: SAU23_ARATH (Auxin-responsive protein SAUR23 OS=Arabidopsis thaliana GN=SAUR23 PE=2 SV=1) HSP 1 Score: 115.9 bits (289), Expect = 2.1e-25 Identity = 51/78 (65.38%), Postives = 63/78 (80.77%), Query Frame = 1
BLAST of CmoCh19G007180 vs. TrEMBL
Match: A0A0A0K4I7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G008440 PE=4 SV=1) HSP 1 Score: 172.6 bits (436), Expect = 2.1e-40 Identity = 83/85 (97.65%), Postives = 83/85 (97.65%), Query Frame = 1
BLAST of CmoCh19G007180 vs. TrEMBL
Match: A0A067K719_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_19614 PE=4 SV=1) HSP 1 Score: 124.4 bits (311), Expect = 6.6e-26 Identity = 55/78 (70.51%), Postives = 64/78 (82.05%), Query Frame = 1
BLAST of CmoCh19G007180 vs. TrEMBL
Match: A0A067JXR9_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_19618 PE=4 SV=1) HSP 1 Score: 124.0 bits (310), Expect = 8.6e-26 Identity = 55/79 (69.62%), Postives = 64/79 (81.01%), Query Frame = 1
BLAST of CmoCh19G007180 vs. TrEMBL
Match: D7SPQ7_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_04s0023g00490 PE=4 SV=1) HSP 1 Score: 124.0 bits (310), Expect = 8.6e-26 Identity = 54/82 (65.85%), Postives = 69/82 (84.15%), Query Frame = 1
BLAST of CmoCh19G007180 vs. TrEMBL
Match: M4CD44_BRARP (Uncharacterized protein OS=Brassica rapa subsp. pekinensis PE=4 SV=1) HSP 1 Score: 122.9 bits (307), Expect = 1.9e-25 Identity = 53/75 (70.67%), Postives = 66/75 (88.00%), Query Frame = 1
BLAST of CmoCh19G007180 vs. TAIR10
Match: AT5G18030.1 (AT5G18030.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 118.2 bits (295), Expect = 2.4e-27 Identity = 52/72 (72.22%), Postives = 61/72 (84.72%), Query Frame = 1
BLAST of CmoCh19G007180 vs. TAIR10
Match: AT5G18080.1 (AT5G18080.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 117.5 bits (293), Expect = 4.1e-27 Identity = 51/78 (65.38%), Postives = 63/78 (80.77%), Query Frame = 1
BLAST of CmoCh19G007180 vs. TAIR10
Match: AT5G18020.1 (AT5G18020.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 117.1 bits (292), Expect = 5.4e-27 Identity = 51/77 (66.23%), Postives = 63/77 (81.82%), Query Frame = 1
BLAST of CmoCh19G007180 vs. TAIR10
Match: AT5G18050.1 (AT5G18050.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 116.7 bits (291), Expect = 7.0e-27 Identity = 50/78 (64.10%), Postives = 64/78 (82.05%), Query Frame = 1
BLAST of CmoCh19G007180 vs. TAIR10
Match: AT5G18060.1 (AT5G18060.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 115.9 bits (289), Expect = 1.2e-26 Identity = 51/78 (65.38%), Postives = 63/78 (80.77%), Query Frame = 1
BLAST of CmoCh19G007180 vs. NCBI nr
Match: gi|778722813|ref|XP_011658572.1| (PREDICTED: auxin-induced protein 15A-like [Cucumis sativus]) HSP 1 Score: 172.6 bits (436), Expect = 3.0e-40 Identity = 83/85 (97.65%), Postives = 83/85 (97.65%), Query Frame = 1
BLAST of CmoCh19G007180 vs. NCBI nr
Match: gi|659094348|ref|XP_008448012.1| (PREDICTED: auxin-induced protein 15A-like [Cucumis melo]) HSP 1 Score: 168.7 bits (426), Expect = 4.4e-39 Identity = 81/85 (95.29%), Postives = 82/85 (96.47%), Query Frame = 1
BLAST of CmoCh19G007180 vs. NCBI nr
Match: gi|802707914|ref|XP_012084407.1| (PREDICTED: auxin-induced protein 15A-like [Jatropha curcas]) HSP 1 Score: 124.4 bits (311), Expect = 9.5e-26 Identity = 55/78 (70.51%), Postives = 64/78 (82.05%), Query Frame = 1
BLAST of CmoCh19G007180 vs. NCBI nr
Match: gi|297735274|emb|CBI17636.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 124.0 bits (310), Expect = 1.2e-25 Identity = 54/82 (65.85%), Postives = 69/82 (84.15%), Query Frame = 1
BLAST of CmoCh19G007180 vs. NCBI nr
Match: gi|731387422|ref|XP_002271994.2| (PREDICTED: LOW QUALITY PROTEIN: uncharacterized protein LOC100256454 [Vitis vinifera]) HSP 1 Score: 124.0 bits (310), Expect = 1.2e-25 Identity = 54/82 (65.85%), Postives = 69/82 (84.15%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |