CmoCh08G006720 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGAAGTCCCTGCAAGGCCGCGTGGTCTGCGCCACCAACGACAAGACCGTTGCCGTCGAAGTCGTGCGATTGGCGCCTCATCCGAAGTACAAACGGCGCATCAGAATCAAGAAGAAGTACCAGGCACACGATCCGGATAACCAGTTCAAGGTCGGAGACTTTGTGGAGCTTGAGAAATGCCGGCCGATTAGCAAGATGAAGACGTTCCTCGCCATTCCGGTTCCGGCAAGGAATTCGAAGCAGAAGGTGGCGGAAGCTGCGGCTGGGGACCTTGGGATTCCATTGGAGTCTCAGCAACAGGTTTAA ATGAAGTCCCTGCAAGGCCGCGTGGTCTGCGCCACCAACGACAAGACCGTTGCCGTCGAAGTCGTGCGATTGGCGCCTCATCCGAAGTACAAACGGCGCATCAGAATCAAGAAGAAGTACCAGGCACACGATCCGGATAACCAGTTCAAGGTCGGAGACTTTGTGGAGCTTGAGAAATGCCGGCCGATTAGCAAGATGAAGACGTTCCTCGCCATTCCGGTTCCGGCAAGGAATTCGAAGCAGAAGGTGGCGGAAGCTGCGGCTGGGGACCTTGGGATTCCATTGGAGTCTCAGCAACAGGTTTAA ATGAAGTCCCTGCAAGGCCGCGTGGTCTGCGCCACCAACGACAAGACCGTTGCCGTCGAAGTCGTGCGATTGGCGCCTCATCCGAAGTACAAACGGCGCATCAGAATCAAGAAGAAGTACCAGGCACACGATCCGGATAACCAGTTCAAGGTCGGAGACTTTGTGGAGCTTGAGAAATGCCGGCCGATTAGCAAGATGAAGACGTTCCTCGCCATTCCGGTTCCGGCAAGGAATTCGAAGCAGAAGGTGGCGGAAGCTGCGGCTGGGGACCTTGGGATTCCATTGGAGTCTCAGCAACAGGTTTAA
BLAST of CmoCh08G006720 vs. Swiss-Prot
Match: RR17_ARATH (30S ribosomal protein S17, chloroplastic OS=Arabidopsis thaliana GN=RPS17 PE=1 SV=1) HSP 1 Score: 146.0 bits (367), Expect = 2.3e-34 Identity = 75/100 (75.00%), Postives = 88/100 (88.00%), Query Frame = 1
BLAST of CmoCh08G006720 vs. Swiss-Prot
Match: RR17_PEA (30S ribosomal protein S17, chloroplastic (Fragment) OS=Pisum sativum GN=RPS17 PE=2 SV=1) HSP 1 Score: 141.0 bits (354), Expect = 7.3e-33 Identity = 67/100 (67.00%), Postives = 86/100 (86.00%), Query Frame = 1
BLAST of CmoCh08G006720 vs. Swiss-Prot
Match: RR17_ORYSJ (30S ribosomal protein S17, chloroplastic OS=Oryza sativa subsp. japonica GN=RPS17 PE=2 SV=1) HSP 1 Score: 124.8 bits (312), Expect = 5.4e-28 Identity = 66/99 (66.67%), Postives = 74/99 (74.75%), Query Frame = 1
BLAST of CmoCh08G006720 vs. Swiss-Prot
Match: RR17_MAIZE (30S ribosomal protein S17, chloroplastic OS=Zea mays GN=RPS17 PE=2 SV=1) HSP 1 Score: 121.3 bits (303), Expect = 6.0e-27 Identity = 60/81 (74.07%), Postives = 67/81 (82.72%), Query Frame = 1
BLAST of CmoCh08G006720 vs. Swiss-Prot
Match: RS17_RHOS1 (30S ribosomal protein S17 OS=Rhodobacter sphaeroides (strain ATCC 17029 / ATH 2.4.9) GN=rpsQ PE=3 SV=1) HSP 1 Score: 76.6 bits (187), Expect = 1.7e-13 Identity = 36/69 (52.17%), Postives = 47/69 (68.12%), Query Frame = 1
BLAST of CmoCh08G006720 vs. TrEMBL
Match: A0A0A0K952_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G446990 PE=3 SV=1) HSP 1 Score: 179.9 bits (455), Expect = 1.6e-42 Identity = 90/101 (89.11%), Postives = 95/101 (94.06%), Query Frame = 1
BLAST of CmoCh08G006720 vs. TrEMBL
Match: W9RUW3_9ROSA (30S ribosomal protein S17 OS=Morus notabilis GN=L484_026214 PE=3 SV=1) HSP 1 Score: 163.3 bits (412), Expect = 1.5e-37 Identity = 78/99 (78.79%), Postives = 92/99 (92.93%), Query Frame = 1
BLAST of CmoCh08G006720 vs. TrEMBL
Match: D7U0I2_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_09s0002g04330 PE=3 SV=1) HSP 1 Score: 159.8 bits (403), Expect = 1.7e-36 Identity = 82/99 (82.83%), Postives = 89/99 (89.90%), Query Frame = 1
BLAST of CmoCh08G006720 vs. TrEMBL
Match: A0A0D2ULD7_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_009G135000 PE=3 SV=1) HSP 1 Score: 159.8 bits (403), Expect = 1.7e-36 Identity = 79/99 (79.80%), Postives = 90/99 (90.91%), Query Frame = 1
BLAST of CmoCh08G006720 vs. TrEMBL
Match: A0A061GAC0_THECC (Ribosomal protein S17 OS=Theobroma cacao GN=TCM_028766 PE=3 SV=1) HSP 1 Score: 157.9 bits (398), Expect = 6.4e-36 Identity = 76/99 (76.77%), Postives = 90/99 (90.91%), Query Frame = 1
BLAST of CmoCh08G006720 vs. TAIR10
Match: AT1G79850.1 (AT1G79850.1 ribosomal protein S17) HSP 1 Score: 146.0 bits (367), Expect = 1.3e-35 Identity = 75/100 (75.00%), Postives = 88/100 (88.00%), Query Frame = 1
BLAST of CmoCh08G006720 vs. TAIR10
Match: AT1G49400.1 (AT1G49400.1 Nucleic acid-binding, OB-fold-like protein) HSP 1 Score: 47.4 bits (111), Expect = 6.2e-06 Identity = 32/89 (35.96%), Postives = 46/89 (51.69%), Query Frame = 1
BLAST of CmoCh08G006720 vs. NCBI nr
Match: gi|659124452|ref|XP_008462167.1| (PREDICTED: 30S ribosomal protein S17, chloroplastic [Cucumis melo]) HSP 1 Score: 180.6 bits (457), Expect = 1.3e-42 Identity = 91/101 (90.10%), Postives = 95/101 (94.06%), Query Frame = 1
BLAST of CmoCh08G006720 vs. NCBI nr
Match: gi|449448022|ref|XP_004141765.1| (PREDICTED: 30S ribosomal protein S17, chloroplastic [Cucumis sativus]) HSP 1 Score: 179.9 bits (455), Expect = 2.3e-42 Identity = 90/101 (89.11%), Postives = 95/101 (94.06%), Query Frame = 1
BLAST of CmoCh08G006720 vs. NCBI nr
Match: gi|703104735|ref|XP_010098081.1| (30S ribosomal protein S17 [Morus notabilis]) HSP 1 Score: 163.3 bits (412), Expect = 2.2e-37 Identity = 78/99 (78.79%), Postives = 92/99 (92.93%), Query Frame = 1
BLAST of CmoCh08G006720 vs. NCBI nr
Match: gi|297743261|emb|CBI36128.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 159.8 bits (403), Expect = 2.4e-36 Identity = 82/99 (82.83%), Postives = 89/99 (89.90%), Query Frame = 1
BLAST of CmoCh08G006720 vs. NCBI nr
Match: gi|823220540|ref|XP_012442970.1| (PREDICTED: 30S ribosomal protein S17, chloroplastic-like [Gossypium raimondii]) HSP 1 Score: 159.8 bits (403), Expect = 2.4e-36 Identity = 79/99 (79.80%), Postives = 90/99 (90.91%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene: |