CmoCh05G006010 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGCAATTTCTATTATTTATACGTTATCCACAAAAAGACGAGCGAAATCGGATTGTCAACTCCATCAAAATCACAGCGGCGATCATCATGTCCAATCAATCAAGACCAGGGATCAGCCGGACTCTCTACGACTCCCCTCCCTCCTCTCGCCACATCGTCAAGTTCTTGACGGCTGCAACCATCGGTACCATCTTCCTCGTCTCTTCTGGATTGACTATAACAGGAACAGTTCTAATCCTCATACTGTCCACTCCGATTCTCGTCTTGTTTAGTCCGATTTTGGTACCCGCGGCAACTGTTCTGGTCCTGGCGGCTGCCGGATTCTTCTTCTCCGCAAGTTGTGCGGTGGCAGCGATAGCGGCACTGACGTGGATGTACAGGTACGTGACGGTGAAGAGGCCGCTAGAGGCAAAATTACAGAAACGGGGAGGGAGATGA ATGCAATTTCTATTATTTATACGTTATCCACAAAAAGACGAGCGAAATCGGATTGTCAACTCCATCAAAATCACAGCGGCGATCATCATGTCCAATCAATCAAGACCAGGGATCAGCCGGACTCTCTACGACTCCCCTCCCTCCTCTCGCCACATCGTCAAGTTCTTGACGGCTGCAACCATCGGTACCATCTTCCTCGTCTCTTCTGGATTGACTATAACAGGAACAGTTCTAATCCTCATACTGTCCACTCCGATTCTCGTCTTGTTTAGTCCGATTTTGGTACCCGCGGCAACTGTTCTGGTCCTGGCGGCTGCCGGATTCTTCTTCTCCGCAAGTTGTGCGGTGGCAGCGATAGCGGCACTGACGTGGATGTACAGGTACGTGACGGTGAAGAGGCCGCTAGAGGCAAAATTACAGAAACGGGGAGGGAGATGA ATGCAATTTCTATTATTTATACGTTATCCACAAAAAGACGAGCGAAATCGGATTGTCAACTCCATCAAAATCACAGCGGCGATCATCATGTCCAATCAATCAAGACCAGGGATCAGCCGGACTCTCTACGACTCCCCTCCCTCCTCTCGCCACATCGTCAAGTTCTTGACGGCTGCAACCATCGGTACCATCTTCCTCGTCTCTTCTGGATTGACTATAACAGGAACAGTTCTAATCCTCATACTGTCCACTCCGATTCTCGTCTTGTTTAGTCCGATTTTGGTACCCGCGGCAACTGTTCTGGTCCTGGCGGCTGCCGGATTCTTCTTCTCCGCAAGTTGTGCGGTGGCAGCGATAGCGGCACTGACGTGGATGTACAGGTACGTGACGGTGAAGAGGCCGCTAGAGGCAAAATTACAGAAACGGGGAGGGAGATGA
BLAST of CmoCh05G006010 vs. Swiss-Prot
Match: OLEO1_ORYSJ (Oleosin 16 kDa OS=Oryza sativa subsp. japonica GN=OLE16 PE=2 SV=3) HSP 1 Score: 75.1 bits (183), Expect = 7.1e-13 Identity = 45/91 (49.45%), Postives = 60/91 (65.93%), Query Frame = 1
BLAST of CmoCh05G006010 vs. Swiss-Prot
Match: OLEO1_MAIZE (Oleosin Zm-I OS=Zea mays GN=OLE16 PE=2 SV=2) HSP 1 Score: 73.9 bits (180), Expect = 1.6e-12 Identity = 44/82 (53.66%), Postives = 57/82 (69.51%), Query Frame = 1
BLAST of CmoCh05G006010 vs. Swiss-Prot
Match: OLEO3_ARATH (Oleosin 14.9 kDa OS=Arabidopsis thaliana GN=OL3 PE=2 SV=2) HSP 1 Score: 71.6 bits (174), Expect = 7.8e-12 Identity = 47/105 (44.76%), Postives = 68/105 (64.76%), Query Frame = 1
BLAST of CmoCh05G006010 vs. Swiss-Prot
Match: OLEO1_PRUDU (Oleosin 1 OS=Prunus dulcis GN=OLE1 PE=2 SV=1) HSP 1 Score: 71.2 bits (173), Expect = 1.0e-11 Identity = 42/88 (47.73%), Postives = 56/88 (63.64%), Query Frame = 1
BLAST of CmoCh05G006010 vs. Swiss-Prot
Match: OLE16_BROSE (Oleosin 16 kDa OS=Bromus secalinus GN=OLE16 PE=2 SV=1) HSP 1 Score: 69.3 bits (168), Expect = 3.9e-11 Identity = 41/82 (50.00%), Postives = 56/82 (68.29%), Query Frame = 1
BLAST of CmoCh05G006010 vs. TrEMBL
Match: A0A0A0LRY3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G372860 PE=4 SV=1) HSP 1 Score: 139.4 bits (350), Expect = 3.4e-30 Identity = 81/109 (74.31%), Postives = 94/109 (86.24%), Query Frame = 1
BLAST of CmoCh05G006010 vs. TrEMBL
Match: A5BPD9_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_04s0008g00540 PE=4 SV=1) HSP 1 Score: 115.9 bits (289), Expect = 4.0e-23 Identity = 67/105 (63.81%), Postives = 80/105 (76.19%), Query Frame = 1
BLAST of CmoCh05G006010 vs. TrEMBL
Match: R0FZR3_9BRAS (Oleosin OS=Capsella rubella GN=CARUB_v10024833mg PE=3 SV=1) HSP 1 Score: 113.6 bits (283), Expect = 2.0e-22 Identity = 64/106 (60.38%), Postives = 81/106 (76.42%), Query Frame = 1
BLAST of CmoCh05G006010 vs. TrEMBL
Match: A0A0J8D1S5_BETVU (Oleosin OS=Beta vulgaris subsp. vulgaris GN=BVRB_2g032920 PE=3 SV=1) HSP 1 Score: 112.5 bits (280), Expect = 4.4e-22 Identity = 61/105 (58.10%), Postives = 82/105 (78.10%), Query Frame = 1
BLAST of CmoCh05G006010 vs. TrEMBL
Match: A0A0D2V8E6_GOSRA (Oleosin OS=Gossypium raimondii GN=B456_010G103700 PE=3 SV=1) HSP 1 Score: 106.3 bits (264), Expect = 3.2e-20 Identity = 57/105 (54.29%), Postives = 79/105 (75.24%), Query Frame = 1
BLAST of CmoCh05G006010 vs. TAIR10
Match: AT2G25890.1 (AT2G25890.1 Oleosin family protein) HSP 1 Score: 105.9 bits (263), Expect = 2.1e-23 Identity = 60/105 (57.14%), Postives = 78/105 (74.29%), Query Frame = 1
BLAST of CmoCh05G006010 vs. TAIR10
Match: AT5G51210.1 (AT5G51210.1 oleosin3) HSP 1 Score: 71.6 bits (174), Expect = 4.4e-13 Identity = 47/105 (44.76%), Postives = 68/105 (64.76%), Query Frame = 1
BLAST of CmoCh05G006010 vs. TAIR10
Match: AT4G25140.1 (AT4G25140.1 oleosin 1) HSP 1 Score: 66.6 bits (161), Expect = 1.4e-11 Identity = 41/86 (47.67%), Postives = 53/86 (61.63%), Query Frame = 1
BLAST of CmoCh05G006010 vs. TAIR10
Match: AT3G01570.1 (AT3G01570.1 Oleosin family protein) HSP 1 Score: 53.5 bits (127), Expect = 1.2e-07 Identity = 33/97 (34.02%), Postives = 56/97 (57.73%), Query Frame = 1
BLAST of CmoCh05G006010 vs. TAIR10
Match: AT3G27660.1 (AT3G27660.1 oleosin 4) HSP 1 Score: 47.8 bits (112), Expect = 6.8e-06 Identity = 28/83 (33.73%), Postives = 50/83 (60.24%), Query Frame = 1
BLAST of CmoCh05G006010 vs. NCBI nr
Match: gi|449461395|ref|XP_004148427.1| (PREDICTED: oleosin 16 kDa-like [Cucumis sativus]) HSP 1 Score: 139.4 bits (350), Expect = 4.9e-30 Identity = 81/109 (74.31%), Postives = 94/109 (86.24%), Query Frame = 1
BLAST of CmoCh05G006010 vs. NCBI nr
Match: gi|659088441|ref|XP_008444982.1| (PREDICTED: oleosin 1-like [Cucumis melo]) HSP 1 Score: 136.0 bits (341), Expect = 5.4e-29 Identity = 77/109 (70.64%), Postives = 91/109 (83.49%), Query Frame = 1
BLAST of CmoCh05G006010 vs. NCBI nr
Match: gi|225429404|ref|XP_002275496.1| (PREDICTED: oleosin 1 [Vitis vinifera]) HSP 1 Score: 115.9 bits (289), Expect = 5.8e-23 Identity = 67/105 (63.81%), Postives = 80/105 (76.19%), Query Frame = 1
BLAST of CmoCh05G006010 vs. NCBI nr
Match: gi|565476146|ref|XP_006295714.1| (hypothetical protein CARUB_v10024833mg [Capsella rubella]) HSP 1 Score: 113.6 bits (283), Expect = 2.9e-22 Identity = 64/106 (60.38%), Postives = 81/106 (76.42%), Query Frame = 1
BLAST of CmoCh05G006010 vs. NCBI nr
Match: gi|731317417|ref|XP_010668835.1| (PREDICTED: oleosin 16 kDa [Beta vulgaris subsp. vulgaris]) HSP 1 Score: 112.5 bits (280), Expect = 6.4e-22 Identity = 61/105 (58.10%), Postives = 82/105 (78.10%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|