CmoCh02G011390 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGTCGAGCAATCTCACCCGTCTATTCTCGCCGCCTAGTCTCACCGCTCTATCGGCGGTGAATCGCGCCACTTCCATTTCGGTGAGTCGACTCGTCTCCTCCTCGGCGAATCAGCAACCTTCTCGATTGGAGCAAGGTGTTCCCGGCGAGGAGCAACGAGAAGCTGGAAAAGGAAGTTTGCCGGATCAACACGAGGCTGCCGGTGATGATCGAGATAGTGAAGATGAGGGAGCTGATGTGAACAAAGCGACCGGCGAGGTCGGTGGACCTAAAGGTCCCGAGCCAACTCGCTATGGCGATTGGGAAAGAAACGGTCGGTGCTACGATTTTTGA ATGTCGAGCAATCTCACCCGTCTATTCTCGCCGCCTAGTCTCACCGCTCTATCGGCGGTGAATCGCGCCACTTCCATTTCGGTGAGTCGACTCGTCTCCTCCTCGGCGAATCAGCAACCTTCTCGATTGGAGCAAGGTGTTCCCGGCGAGGAGCAACGAGAAGCTGGAAAAGGAAGTTTGCCGGATCAACACGAGGCTGCCGGTGATGATCGAGATAGTGAAGATGAGGGAGCTGATGTGAACAAAGCGACCGGCGAGGTCGGTGGACCTAAAGGTCCCGAGCCAACTCGCTATGGCGATTGGGAAAGAAACGGTCGGTGCTACGATTTTTGA ATGTCGAGCAATCTCACCCGTCTATTCTCGCCGCCTAGTCTCACCGCTCTATCGGCGGTGAATCGCGCCACTTCCATTTCGGTGAGTCGACTCGTCTCCTCCTCGGCGAATCAGCAACCTTCTCGATTGGAGCAAGGTGTTCCCGGCGAGGAGCAACGAGAAGCTGGAAAAGGAAGTTTGCCGGATCAACACGAGGCTGCCGGTGATGATCGAGATAGTGAAGATGAGGGAGCTGATGTGAACAAAGCGACCGGCGAGGTCGGTGGACCTAAAGGTCCCGAGCCAACTCGCTATGGCGATTGGGAAAGAAACGGTCGGTGCTACGATTTTTGA
BLAST of CmoCh02G011390 vs. Swiss-Prot
Match: SDHF4_MOUSE (Succinate dehydrogenase assembly factor 4, mitochondrial OS=Mus musculus GN=Sdhaf4 PE=3 SV=2) HSP 1 Score: 58.5 bits (140), Expect = 5.2e-08 Identity = 42/102 (41.18%), Postives = 56/102 (54.90%), Query Frame = 1
BLAST of CmoCh02G011390 vs. Swiss-Prot
Match: SDHF4_DROME (Succinate dehydrogenase assembly factor 4, mitochondrial OS=Drosophila melanogaster GN=Sirup PE=3 SV=2) HSP 1 Score: 55.5 bits (132), Expect = 4.4e-07 Identity = 23/30 (76.67%), Postives = 24/30 (80.00%), Query Frame = 1
BLAST of CmoCh02G011390 vs. Swiss-Prot
Match: SDHF4_HUMAN (Succinate dehydrogenase assembly factor 4, mitochondrial OS=Homo sapiens GN=SDHAF4 PE=3 SV=1) HSP 1 Score: 53.9 bits (128), Expect = 1.3e-06 Identity = 45/113 (39.82%), Postives = 52/113 (46.02%), Query Frame = 1
BLAST of CmoCh02G011390 vs. TrEMBL
Match: A0A0A0KQ66_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G139490 PE=4 SV=1) HSP 1 Score: 152.9 bits (385), Expect = 2.2e-34 Identity = 82/111 (73.87%), Postives = 93/111 (83.78%), Query Frame = 1
BLAST of CmoCh02G011390 vs. TrEMBL
Match: M5XLA3_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa013634mg PE=4 SV=1) HSP 1 Score: 89.7 bits (221), Expect = 2.3e-15 Identity = 59/116 (50.86%), Postives = 72/116 (62.07%), Query Frame = 1
BLAST of CmoCh02G011390 vs. TrEMBL
Match: W9RP47_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_000138 PE=4 SV=1) HSP 1 Score: 88.6 bits (218), Expect = 5.2e-15 Identity = 62/122 (50.82%), Postives = 76/122 (62.30%), Query Frame = 1
BLAST of CmoCh02G011390 vs. TrEMBL
Match: I3S0H7_LOTJA (Uncharacterized protein OS=Lotus japonicus PE=2 SV=1) HSP 1 Score: 82.0 bits (201), Expect = 4.9e-13 Identity = 51/105 (48.57%), Postives = 67/105 (63.81%), Query Frame = 1
BLAST of CmoCh02G011390 vs. TrEMBL
Match: A0A061G1Q2_THECC (Uncharacterized protein OS=Theobroma cacao GN=TCM_015376 PE=4 SV=1) HSP 1 Score: 81.3 bits (199), Expect = 8.3e-13 Identity = 57/118 (48.31%), Postives = 73/118 (61.86%), Query Frame = 1
BLAST of CmoCh02G011390 vs. TAIR10
Match: AT5G67490.1 (AT5G67490.1 unknown protein) HSP 1 Score: 58.2 bits (139), Expect = 3.8e-09 Identity = 43/99 (43.43%), Postives = 52/99 (52.53%), Query Frame = 1
BLAST of CmoCh02G011390 vs. NCBI nr
Match: gi|778708202|ref|XP_011656145.1| (PREDICTED: succinate dehydrogenase assembly factor 4, mitochondrial [Cucumis sativus]) HSP 1 Score: 152.9 bits (385), Expect = 3.2e-34 Identity = 82/111 (73.87%), Postives = 93/111 (83.78%), Query Frame = 1
BLAST of CmoCh02G011390 vs. NCBI nr
Match: gi|659074410|ref|XP_008437589.1| (PREDICTED: UPF0369 protein C6orf57 homolog [Cucumis melo]) HSP 1 Score: 146.4 bits (368), Expect = 3.0e-32 Identity = 80/111 (72.07%), Postives = 90/111 (81.08%), Query Frame = 1
BLAST of CmoCh02G011390 vs. NCBI nr
Match: gi|596011648|ref|XP_007218626.1| (hypothetical protein PRUPE_ppa013634mg [Prunus persica]) HSP 1 Score: 89.7 bits (221), Expect = 3.4e-15 Identity = 59/116 (50.86%), Postives = 72/116 (62.07%), Query Frame = 1
BLAST of CmoCh02G011390 vs. NCBI nr
Match: gi|703114907|ref|XP_010100771.1| (hypothetical protein L484_006836 [Morus notabilis]) HSP 1 Score: 88.6 bits (218), Expect = 7.5e-15 Identity = 62/122 (50.82%), Postives = 76/122 (62.30%), Query Frame = 1
BLAST of CmoCh02G011390 vs. NCBI nr
Match: gi|657969991|ref|XP_008376732.1| (PREDICTED: UPF0369 protein C6orf57-like [Malus domestica]) HSP 1 Score: 87.4 bits (215), Expect = 1.7e-14 Identity = 55/113 (48.67%), Postives = 74/113 (65.49%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |