CSPI05G21300 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCTGGACTTTTGGGATTTAGTGGCCTTGGACCTAAGACAAAGAATATCGTTGTTGCCGGAGGTTTGACTGCATTTGTCTTCGGGGTATATTTCTACACCATGAGAGCAGTTGGAGGTTCGGATGAACTGCAAGTAGCCATTGACCAGTTTGAATCGCAGAAAAGAAACAAGGAATCGAATGTGTAG ATGGCTGGACTTTTGGGATTTAGTGGCCTTGGACCTAAGACAAAGAATATCGTTGTTGCCGGAGGTTTGACTGCATTTGTCTTCGGGGTATATTTCTACACCATGAGAGCAGTTGGAGGTTCGGATGAACTGCAAGTAGCCATTGACCAGTTTGAATCGCAGAAAAGAAACAAGGAATCGAATGTGTAG ATGGCTGGACTTTTGGGATTTAGTGGCCTTGGACCTAAGACAAAGAATATCGTTGTTGCCGGAGGTTTGACTGCATTTGTCTTCGGGGTATATTTCTACACCATGAGAGCAGTTGGAGGTTCGGATGAACTGCAAGTAGCCATTGACCAGTTTGAATCGCAGAAAAGAAACAAGGAATCGAATGTGTAG
BLAST of CSPI05G21300 vs. TrEMBL
Match: A0A0A0KPU8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G589280 PE=4 SV=1) HSP 1 Score: 122.5 bits (306), Expect = 1.9e-25 Identity = 62/62 (100.00%), Postives = 62/62 (100.00%), Query Frame = 1
BLAST of CSPI05G21300 vs. TrEMBL
Match: R0HF55_9BRAS (Uncharacterized protein OS=Capsella rubella GN=CARUB_v10024467mg PE=4 SV=1) HSP 1 Score: 97.1 bits (240), Expect = 8.4e-18 Identity = 48/61 (78.69%), Postives = 54/61 (88.52%), Query Frame = 1
BLAST of CSPI05G21300 vs. TrEMBL
Match: G7KSN0_MEDTR (Transmembrane protein, putative OS=Medicago truncatula GN=MTR_7g091060 PE=2 SV=2) HSP 1 Score: 97.1 bits (240), Expect = 8.4e-18 Identity = 46/59 (77.97%), Postives = 52/59 (88.14%), Query Frame = 1
BLAST of CSPI05G21300 vs. TrEMBL
Match: A0A061EJ76_THECC (Uncharacterized protein OS=Theobroma cacao GN=TCM_019853 PE=4 SV=1) HSP 1 Score: 96.7 bits (239), Expect = 1.1e-17 Identity = 46/58 (79.31%), Postives = 53/58 (91.38%), Query Frame = 1
BLAST of CSPI05G21300 vs. TrEMBL
Match: A0A022R8T3_ERYGU (Uncharacterized protein OS=Erythranthe guttata GN=MIMGU_mgv1a017543mg PE=4 SV=1) HSP 1 Score: 95.1 bits (235), Expect = 3.2e-17 Identity = 45/59 (76.27%), Postives = 51/59 (86.44%), Query Frame = 1
BLAST of CSPI05G21300 vs. TAIR10
Match: AT2G43780.1 (AT2G43780.1 unknown protein) HSP 1 Score: 93.2 bits (230), Expect = 6.1e-20 Identity = 47/56 (83.93%), Postives = 50/56 (89.29%), Query Frame = 1
BLAST of CSPI05G21300 vs. NCBI nr
Match: gi|778704559|ref|XP_011655556.1| (PREDICTED: uncharacterized protein LOC105435556 [Cucumis sativus]) HSP 1 Score: 122.5 bits (306), Expect = 2.7e-25 Identity = 62/62 (100.00%), Postives = 62/62 (100.00%), Query Frame = 1
BLAST of CSPI05G21300 vs. NCBI nr
Match: gi|659090456|ref|XP_008446026.1| (PREDICTED: uncharacterized protein LOC103488878 [Cucumis melo]) HSP 1 Score: 116.3 bits (290), Expect = 1.9e-23 Identity = 58/62 (93.55%), Postives = 61/62 (98.39%), Query Frame = 1
BLAST of CSPI05G21300 vs. NCBI nr
Match: gi|565475468|ref|XP_006295375.1| (hypothetical protein CARUB_v10024467mg [Capsella rubella]) HSP 1 Score: 97.1 bits (240), Expect = 1.2e-17 Identity = 48/61 (78.69%), Postives = 54/61 (88.52%), Query Frame = 1
BLAST of CSPI05G21300 vs. NCBI nr
Match: gi|922340201|ref|XP_003625112.2| (transmembrane protein, putative [Medicago truncatula]) HSP 1 Score: 97.1 bits (240), Expect = 1.2e-17 Identity = 46/59 (77.97%), Postives = 52/59 (88.14%), Query Frame = 1
BLAST of CSPI05G21300 vs. NCBI nr
Match: gi|1009112792|ref|XP_015870175.1| (PREDICTED: uncharacterized protein LOC107407403 [Ziziphus jujuba]) HSP 1 Score: 96.7 bits (239), Expect = 1.6e-17 Identity = 46/60 (76.67%), Postives = 54/60 (90.00%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|