CSPI04G05850 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: five_prime_UTRCDSthree_prime_UTR Hold the cursor over a type above to highlight its positions in the sequence below.TAATTATCATAAACCTTCCCTTAATCATGATTCCATTTGTTAAAATAAACAAAAAAAAAAGTGTTAATTAGACTGAGTAACCTTAATCGGAGGAGCAGGCTGGCCGGCCGCAGTAGCATTCCAATTTCCACAACCTCTATAAATTCACAATCCTCCTTTCATGAATCTTCAATAGAAATCTCGAAGAATCTCCGGCTGTTTTCCGATCCAATGAGGCAAGCGGGGGCATATTCCGGCGTGATGTACTGGAAAACAGGACCACACTCGCTGCCGTTAGCGAGGATAAAGAAGATCATGAAGAAATCGGGAGAGGAGGTGAAGATGATCTCCGGTGAGGCTCCGATCGTGTTCTCGAAGGCGTGTGAATTGTTCATCGAAGAATTGACGAAGAGATCGTGGATGATTGCGATGCAGAGTAAGAAGAGGATGCTTCATAAAGAGGATGTGGCTTCCGCTATTCTGGCTACGGATGTTTTCGATTTTCTGATCGGATTGATCTTCAATGAAACCGCCACTCCCGCCGCCACCGGAGATCTTGGTGAAGTGAAACTATTTCGGTAGGTTGTTGAAACTTAAAAGAATGGATTGAAGTGTTCTCCATTTCTCTCTGTTTGGAGTGAATTGAAATTTCAATTTGTCAATCTATGATAAAATGTAAAATATGATTCTCATATCTGTGGTTCCATTTATAACAAACAATTTCAGTTATGTCTTTCTCTCCCACTTAAATTATCAAAACAATCATACTCAAAAAATTTCAATGTATCGTAATG ATGAGGCAAGCGGGGGCATATTCCGGCGTGATGTACTGGAAAACAGGACCACACTCGCTGCCGTTAGCGAGGATAAAGAAGATCATGAAGAAATCGGGAGAGGAGGTGAAGATGATCTCCGGTGAGGCTCCGATCGTGTTCTCGAAGGCGTGTGAATTGTTCATCGAAGAATTGACGAAGAGATCGTGGATGATTGCGATGCAGAGTAAGAAGAGGATGCTTCATAAAGAGGATGTGGCTTCCGCTATTCTGGCTACGGATGTTTTCGATTTTCTGATCGGATTGATCTTCAATGAAACCGCCACTCCCGCCGCCACCGGAGATCTTGGTGAAGTGAAACTATTTCGGTAG ATGAGGCAAGCGGGGGCATATTCCGGCGTGATGTACTGGAAAACAGGACCACACTCGCTGCCGTTAGCGAGGATAAAGAAGATCATGAAGAAATCGGGAGAGGAGGTGAAGATGATCTCCGGTGAGGCTCCGATCGTGTTCTCGAAGGCGTGTGAATTGTTCATCGAAGAATTGACGAAGAGATCGTGGATGATTGCGATGCAGAGTAAGAAGAGGATGCTTCATAAAGAGGATGTGGCTTCCGCTATTCTGGCTACGGATGTTTTCGATTTTCTGATCGGATTGATCTTCAATGAAACCGCCACTCCCGCCGCCACCGGAGATCTTGGTGAAGTGAAACTATTTCGGTAG
BLAST of CSPI04G05850 vs. Swiss-Prot
Match: NFYC4_ARATH (Nuclear transcription factor Y subunit C-4 OS=Arabidopsis thaliana GN=NFYC4 PE=2 SV=1) HSP 1 Score: 102.4 bits (254), Expect = 3.3e-21 Identity = 51/82 (62.20%), Postives = 66/82 (80.49%), Query Frame = 1
BLAST of CSPI04G05850 vs. Swiss-Prot
Match: NFYC3_ARATH (Nuclear transcription factor Y subunit C-3 OS=Arabidopsis thaliana GN=NFYC3 PE=2 SV=1) HSP 1 Score: 102.4 bits (254), Expect = 3.3e-21 Identity = 50/93 (53.76%), Postives = 68/93 (73.12%), Query Frame = 1
BLAST of CSPI04G05850 vs. Swiss-Prot
Match: NFYC1_ARATH (Nuclear transcription factor Y subunit C-1 OS=Arabidopsis thaliana GN=NFYC1 PE=1 SV=1) HSP 1 Score: 101.3 bits (251), Expect = 7.4e-21 Identity = 50/79 (63.29%), Postives = 65/79 (82.28%), Query Frame = 1
BLAST of CSPI04G05850 vs. Swiss-Prot
Match: NFYC9_ARATH (Nuclear transcription factor Y subunit C-9 OS=Arabidopsis thaliana GN=NFYC9 PE=2 SV=1) HSP 1 Score: 100.9 bits (250), Expect = 9.7e-21 Identity = 49/92 (53.26%), Postives = 67/92 (72.83%), Query Frame = 1
BLAST of CSPI04G05850 vs. Swiss-Prot
Match: NFYC2_ARATH (Nuclear transcription factor Y subunit C-2 OS=Arabidopsis thaliana GN=NFYC2 PE=2 SV=2) HSP 1 Score: 99.0 bits (245), Expect = 3.7e-20 Identity = 48/79 (60.76%), Postives = 65/79 (82.28%), Query Frame = 1
BLAST of CSPI04G05850 vs. TrEMBL
Match: A0A0A0KZN6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G049050 PE=4 SV=1) HSP 1 Score: 222.2 bits (565), Expect = 3.2e-55 Identity = 111/111 (100.00%), Postives = 111/111 (100.00%), Query Frame = 1
BLAST of CSPI04G05850 vs. TrEMBL
Match: B9RC88_RICCO (Ccaat-binding transcription factor, putative OS=Ricinus communis GN=RCOM_1686190 PE=4 SV=1) HSP 1 Score: 158.7 bits (400), Expect = 4.4e-36 Identity = 77/102 (75.49%), Postives = 90/102 (88.24%), Query Frame = 1
BLAST of CSPI04G05850 vs. TrEMBL
Match: B9GWG1_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0003s12460g PE=4 SV=2) HSP 1 Score: 158.3 bits (399), Expect = 5.7e-36 Identity = 78/104 (75.00%), Postives = 90/104 (86.54%), Query Frame = 1
BLAST of CSPI04G05850 vs. TrEMBL
Match: A0A067K0Y6_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_20620 PE=4 SV=1) HSP 1 Score: 157.9 bits (398), Expect = 7.4e-36 Identity = 77/106 (72.64%), Postives = 92/106 (86.79%), Query Frame = 1
BLAST of CSPI04G05850 vs. TrEMBL
Match: A0A151RNI3_CAJCA (Nuclear transcription factor Y subunit C-1 OS=Cajanus cajan GN=KK1_034434 PE=4 SV=1) HSP 1 Score: 156.8 bits (395), Expect = 1.7e-35 Identity = 81/120 (67.50%), Postives = 98/120 (81.67%), Query Frame = 1
BLAST of CSPI04G05850 vs. TAIR10
Match: AT1G54830.2 (AT1G54830.2 nuclear factor Y, subunit C3) HSP 1 Score: 102.4 bits (254), Expect = 1.9e-22 Identity = 50/93 (53.76%), Postives = 68/93 (73.12%), Query Frame = 1
BLAST of CSPI04G05850 vs. TAIR10
Match: AT5G63470.1 (AT5G63470.1 nuclear factor Y, subunit C4) HSP 1 Score: 102.4 bits (254), Expect = 1.9e-22 Identity = 51/82 (62.20%), Postives = 66/82 (80.49%), Query Frame = 1
BLAST of CSPI04G05850 vs. TAIR10
Match: AT3G48590.1 (AT3G48590.1 nuclear factor Y, subunit C1) HSP 1 Score: 101.3 bits (251), Expect = 4.2e-22 Identity = 50/79 (63.29%), Postives = 65/79 (82.28%), Query Frame = 1
BLAST of CSPI04G05850 vs. TAIR10
Match: AT1G08970.4 (AT1G08970.4 nuclear factor Y, subunit C9) HSP 1 Score: 100.9 bits (250), Expect = 5.5e-22 Identity = 49/92 (53.26%), Postives = 67/92 (72.83%), Query Frame = 1
BLAST of CSPI04G05850 vs. TAIR10
Match: AT1G56170.1 (AT1G56170.1 nuclear factor Y, subunit C2) HSP 1 Score: 99.0 bits (245), Expect = 2.1e-21 Identity = 48/79 (60.76%), Postives = 65/79 (82.28%), Query Frame = 1
BLAST of CSPI04G05850 vs. NCBI nr
Match: gi|449457660|ref|XP_004146566.1| (PREDICTED: nuclear transcription factor Y subunit C-3-like [Cucumis sativus]) HSP 1 Score: 222.2 bits (565), Expect = 4.6e-55 Identity = 111/111 (100.00%), Postives = 111/111 (100.00%), Query Frame = 1
BLAST of CSPI04G05850 vs. NCBI nr
Match: gi|659102234|ref|XP_008452022.1| (PREDICTED: nuclear transcription factor Y subunit C-1-like [Cucumis melo]) HSP 1 Score: 208.0 bits (528), Expect = 9.0e-51 Identity = 106/111 (95.50%), Postives = 107/111 (96.40%), Query Frame = 1
BLAST of CSPI04G05850 vs. NCBI nr
Match: gi|223549671|gb|EEF51159.1| (ccaat-binding transcription factor, putative [Ricinus communis]) HSP 1 Score: 158.7 bits (400), Expect = 6.3e-36 Identity = 77/102 (75.49%), Postives = 90/102 (88.24%), Query Frame = 1
BLAST of CSPI04G05850 vs. NCBI nr
Match: gi|566162320|ref|XP_002304485.2| (hypothetical protein POPTR_0003s12460g [Populus trichocarpa]) HSP 1 Score: 158.3 bits (399), Expect = 8.2e-36 Identity = 78/104 (75.00%), Postives = 90/104 (86.54%), Query Frame = 1
BLAST of CSPI04G05850 vs. NCBI nr
Match: gi|802741967|ref|XP_012087210.1| (PREDICTED: nuclear transcription factor Y subunit C-3-like [Jatropha curcas]) HSP 1 Score: 157.9 bits (398), Expect = 1.1e-35 Identity = 77/106 (72.64%), Postives = 92/106 (86.79%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |