CU092410 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGAAACCAACACTCAAACATCCAAATTCAATCCTCCATCTAATTACTTCATCTACACCATGGGTGGCAACAGGCAAAAGAAATCTCACTCATCTTTTTCAATCTTTAGCTTTTTCAAGTCCAGAAGGGGTCGAAAAGGAGACCACTACGACCATGGTGGCGCTTGGCCGGACGAGATGCCGAGATCCAACAAGGTGTGGCCAAGTGATGAGGACAA
BLAST of CU092410 vs. NCBI nr
Match: gi|700190666|gb|KGN45870.1| (hypothetical protein Csa_6G014900 [Cucumis sativus]) HSP 1 Score: 70.5 bits (171), Expect = 1.4e-09 Identity = 32/52 (61.54%), Postives = 32/52 (61.54%), Query Frame = 3
BLAST of CU092410 vs. NCBI nr
Match: gi|700190663|gb|KGN45867.1| (hypothetical protein Csa_6G014870 [Cucumis sativus]) HSP 1 Score: 66.6 bits (161), Expect = 2.0e-08 Identity = 31/52 (59.62%), Postives = 31/52 (59.62%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|