CU102653 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TACTTCCATTTTCCTATAATGGCCATGGGTGGGGTTGAGGCTAGCTCTCCGGGAGGGATGTCCTTCAATCATGTTCTATATATGTTGATTCTATATATGTTGATGTACCTTCTTTCTCCTAATATATACGATCCACTTGGTGGTGTTTTTACAAGCTATCATAGGAACATAACTCAGCTTACACACACCATCGATTCACGAGTAATCATTGCTGGAATATTTCCTACT
BLAST of CU102653 vs. TrEMBL
Match: A0A0A0KF83_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G091890 PE=4 SV=1) HSP 1 Score: 113.2 bits (282), Expect = 1.4e-22 Identity = 56/69 (81.16%), Postives = 56/69 (81.16%), Query Frame = 1
BLAST of CU102653 vs. NCBI nr
Match: gi|700191212|gb|KGN46416.1| (hypothetical protein Csa_6G091890 [Cucumis sativus]) HSP 1 Score: 114.4 bits (285), Expect = 8.8e-23 Identity = 56/69 (81.16%), Postives = 56/69 (81.16%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|