CU114422 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGTAGGAAATAAAAACAAACTTTATTGGAAGACTTTAACTCTTTTATGTGTAATTTACTTCACACTTGGATTATTTAGATTACAACATTTCAATCCTATTTACAGGATTGTCATGAACTAACTCATACCACACTTAAACCCAATACAGTTTATTCATTAGCTAGAGATTAATTACATATATTACCTTAACTCATAAGGTTTTTGTAAACTCTCATTACATATATCTCAATCACCCCAAGGCAAGCCACACGAAGTTATCAGGACAGGAACTGCTAACGTTATCTGGGCAGTCAATGAGAGTATGACCATCTTTGACATAACATAAAACCGCCTTTTGAAGTTGTATTCGACGATATTGATCAACTGCGCAGATGACGCCACCCTTCTTCAAGGT
BLAST of CU114422 vs. TrEMBL
Match: A0A0A0K4L1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G351900 PE=3 SV=1) HSP 1 Score: 117.9 bits (294), Expect = 9.6e-24 Identity = 54/54 (100.00%), Postives = 54/54 (100.00%), Query Frame = -1
BLAST of CU114422 vs. NCBI nr
Match: gi|778727014|ref|XP_004149779.2| (PREDICTED: ribonuclease MC-like [Cucumis sativus]) HSP 1 Score: 121.7 bits (304), Expect = 9.5e-25 Identity = 54/54 (100.00%), Postives = 54/54 (100.00%), Query Frame = -1
BLAST of CU114422 vs. NCBI nr
Match: gi|700189392|gb|KGN44625.1| (hypothetical protein Csa_7G351900 [Cucumis sativus]) HSP 1 Score: 121.7 bits (304), Expect = 9.5e-25 Identity = 54/54 (100.00%), Postives = 54/54 (100.00%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|