CU117108 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGTGATGGATTTGTCTAGAAAGGGCGTTTTCGTTTCATTTTCCTGCGAATCGGAACCGACCCAGATCGGAAAATGGGATGGGAATGATGGATGAAGAGAATCAGAGAAGAAACAGTTTGGAATTTGTTGAGAATCGGCCGTCGTTTGTGAGAAGAACGTTACAGTGGCTGATGGGAAAGAACAACAATAGGATTGTTCATTCATCTTTTACACCTAATGATGA
BLAST of CU117108 vs. TrEMBL
Match: A0A0A0LH59_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G047810 PE=4 SV=1) HSP 1 Score: 143.7 bits (361), Expect = 9.1e-32 Identity = 67/67 (100.00%), Postives = 67/67 (100.00%), Query Frame = 3
BLAST of CU117108 vs. TrEMBL
Match: B9IM58_POPTR (Zinc finger family protein OS=Populus trichocarpa GN=POPTR_0018s10760g PE=4 SV=2) HSP 1 Score: 69.7 bits (169), Expect = 1.7e-09 Identity = 37/66 (56.06%), Postives = 44/66 (66.67%), Query Frame = 3
BLAST of CU117108 vs. TrEMBL
Match: B9HBN5_POPTR (Zinc finger family protein OS=Populus trichocarpa GN=POPTR_0006s19080g PE=4 SV=1) HSP 1 Score: 62.4 bits (150), Expect = 2.7e-07 Identity = 32/66 (48.48%), Postives = 44/66 (66.67%), Query Frame = 3
BLAST of CU117108 vs. TrEMBL
Match: M1DSC6_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400043193 PE=4 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 5.9e-07 Identity = 40/92 (43.48%), Postives = 47/92 (51.09%), Query Frame = 3
BLAST of CU117108 vs. TrEMBL
Match: K4CBA7_SOLLC (Uncharacterized protein OS=Solanum lycopersicum PE=4 SV=1) HSP 1 Score: 59.7 bits (143), Expect = 1.7e-06 Identity = 38/93 (40.86%), Postives = 46/93 (49.46%), Query Frame = 3
BLAST of CU117108 vs. NCBI nr
Match: gi|449462741|ref|XP_004149099.1| (PREDICTED: RING-H2 finger protein ATL13 [Cucumis sativus]) HSP 1 Score: 142.5 bits (358), Expect = 2.9e-31 Identity = 67/67 (100.00%), Postives = 67/67 (100.00%), Query Frame = 3
BLAST of CU117108 vs. NCBI nr
Match: gi|659069895|ref|XP_008452317.1| (PREDICTED: RING-H2 finger protein ATL13 [Cucumis melo]) HSP 1 Score: 136.0 bits (341), Expect = 2.7e-29 Identity = 64/67 (95.52%), Postives = 65/67 (97.01%), Query Frame = 3
BLAST of CU117108 vs. NCBI nr
Match: gi|566215213|ref|XP_002324500.2| (zinc finger family protein [Populus trichocarpa]) HSP 1 Score: 68.6 bits (166), Expect = 5.3e-09 Identity = 37/66 (56.06%), Postives = 44/66 (66.67%), Query Frame = 3
BLAST of CU117108 vs. NCBI nr
Match: gi|970037907|ref|XP_015080289.1| (PREDICTED: RING-H2 finger protein ATL13 [Solanum pennellii]) HSP 1 Score: 62.0 bits (149), Expect = 5.0e-07 Identity = 39/93 (41.94%), Postives = 48/93 (51.61%), Query Frame = 3
BLAST of CU117108 vs. NCBI nr
Match: gi|224091879|ref|XP_002309383.1| (zinc finger family protein [Populus trichocarpa]) HSP 1 Score: 61.2 bits (147), Expect = 8.5e-07 Identity = 32/66 (48.48%), Postives = 44/66 (66.67%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|