CU122957 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GATACGTTGTTGCGTAGGCGATCAAACGCTGGAGGTGGGTTGTATTGCAGATCTGAGGTGGGTTGCGCCGTCATCTGATCGTGACCCGAGAGAAGCCGCGTCGCCGTCGTAGTAGCCGCTGCCGGAGAGAAATGAGAATTGCAAGAGAAAGAGACAAGTGCGAACCGCTGGGTTGCTTGTAGTCTCTTTTTTCTAATTCCCCGG
BLAST of CU122957 vs. TrEMBL
Match: A0A0A0L663_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G063670 PE=4 SV=1) HSP 1 Score: 71.6 bits (174), Expect = 4.0e-10 Identity = 36/51 (70.59%), Postives = 38/51 (74.51%), Query Frame = -2
BLAST of CU122957 vs. NCBI nr
Match: gi|700200934|gb|KGN56067.1| (hypothetical protein Csa_3G063670 [Cucumis sativus]) HSP 1 Score: 72.0 bits (175), Expect = 4.4e-10 Identity = 36/51 (70.59%), Postives = 38/51 (74.51%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|