CU134385 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GAACCCTGACGATTCAATTCCTCTTCACTTGTTATCGTTAATCATCAACTTCTGATTTCTGGGCAAAGGAATTTGCGGATCTTCATCTTTCACAAGCCTCGCCACAGGCACCACTCTGATGAGAAACGACATATCGCGATTCGCAAGGTAGTCTTCAATTTTATAAGAGAACGAAAGATTTTGTTTCTGATACATCAA
BLAST of CU134385 vs. TrEMBL
Match: A0A0A0LA54_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G354480 PE=4 SV=1) HSP 1 Score: 62.4 bits (150), Expect = 2.4e-07 Identity = 27/29 (93.10%), Postives = 29/29 (100.00%), Query Frame = 1
BLAST of CU134385 vs. NCBI nr
Match: gi|700202721|gb|KGN57854.1| (hypothetical protein Csa_3G354480 [Cucumis sativus]) HSP 1 Score: 60.1 bits (144), Expect = 1.7e-06 Identity = 27/29 (93.10%), Postives = 29/29 (100.00%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|